ID: 1199722850

View in Genome Browser
Species Human (GRCh38)
Location X:150555015-150555037
Sequence CCTCATCTGCAAAAGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199722843_1199722850 13 Left 1199722843 X:150554979-150555001 CCTTGAGATACTCACAGCCTCCC No data
Right 1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG No data
1199722844_1199722850 -4 Left 1199722844 X:150554996-150555018 CCTCCCTGAGACTCAGTTTCCTC No data
Right 1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG No data
1199722846_1199722850 -8 Left 1199722846 X:150555000-150555022 CCTGAGACTCAGTTTCCTCATCT 0: 8
1: 129
2: 796
3: 1960
4: 4006
Right 1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG No data
1199722841_1199722850 29 Left 1199722841 X:150554963-150554985 CCTACCAGCACAATTACCTTGAG No data
Right 1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG No data
1199722842_1199722850 25 Left 1199722842 X:150554967-150554989 CCAGCACAATTACCTTGAGATAC No data
Right 1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG No data
1199722845_1199722850 -7 Left 1199722845 X:150554999-150555021 CCCTGAGACTCAGTTTCCTCATC No data
Right 1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199722850 Original CRISPR CCTCATCTGCAAAAGAGGGA TGG Intergenic
No off target data available for this crispr