ID: 1199723251

View in Genome Browser
Species Human (GRCh38)
Location X:150558435-150558457
Sequence TACTTCCTAGGGGCCTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199723244_1199723251 20 Left 1199723244 X:150558392-150558414 CCAGCTGTCACTAGAAATACTCC No data
Right 1199723251 X:150558435-150558457 TACTTCCTAGGGGCCTGACAGGG No data
1199723246_1199723251 -1 Left 1199723246 X:150558413-150558435 CCTGCTGGAAATGCTACATTTTT No data
Right 1199723251 X:150558435-150558457 TACTTCCTAGGGGCCTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199723251 Original CRISPR TACTTCCTAGGGGCCTGACA GGG Intergenic
No off target data available for this crispr