ID: 1199728617

View in Genome Browser
Species Human (GRCh38)
Location X:150608749-150608771
Sequence GAGACAAAATTTCAGTTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 1, 2: 7, 3: 107, 4: 454}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199728617_1199728620 11 Left 1199728617 X:150608749-150608771 CCTATTAACTGAAATTTTGTCTC 0: 1
1: 1
2: 7
3: 107
4: 454
Right 1199728620 X:150608783-150608805 ATCTCCCCATTGCCTTCCCCAGG 0: 1
1: 0
2: 6
3: 45
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199728617 Original CRISPR GAGACAAAATTTCAGTTAAT AGG (reversed) Intronic
900233182 1:1572855-1572877 AAGACAAAATTATTGTTAATTGG - Intronic
903770586 1:25761539-25761561 GATATAAAATTTCAGTTAGGAGG - Intronic
905064511 1:35168804-35168826 ACAACAAAATTTCAGTTAAGAGG + Intergenic
905192670 1:36247822-36247844 GATACAAAATTTCAGTTAAGAGG - Intronic
905955333 1:41989095-41989117 GACATAAAATTTCAGTTAGATGG + Intronic
906872292 1:49496478-49496500 GATACAAAATTTCGGTTAGGAGG - Intronic
907002500 1:50875814-50875836 GATACAAAATTTCAGTTAGGGGG - Intronic
907168769 1:52440926-52440948 GAGATAACAGTTCATTTAATTGG + Intronic
907168901 1:52442205-52442227 CAGACAAAATGTAAGTTAAATGG + Intronic
907375522 1:54035029-54035051 GACACAACATTTCAGTTAGATGG + Intronic
907612021 1:55880737-55880759 GGGAGAAAAGTTCAGTGAATGGG - Intergenic
908236614 1:62153293-62153315 GAGAGGGAATTTCATTTAATTGG - Intronic
908341350 1:63182866-63182888 GATACAAAATTTCAATTAGATGG + Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909450582 1:75793855-75793877 GAGACCAAACTTCAATTCATAGG - Intronic
910298467 1:85677569-85677591 AAGACAAAATGTCACTGAATAGG - Intronic
910391041 1:86744948-86744970 GAGAGAAAATTTCATTTACTTGG - Intronic
910427057 1:87128817-87128839 GAGACAATATATCATTTATTTGG + Intronic
910937792 1:92500069-92500091 GATACAAAATTTCAATAAACAGG - Intergenic
911249025 1:95553860-95553882 GAGATAAAATTTCAGATATAGGG - Intergenic
911808715 1:102245547-102245569 GAAACAAAACTTCAGTTAGGAGG - Intergenic
912113180 1:106369298-106369320 GAGACGGAATTTCTGTTAAGAGG - Intergenic
913444603 1:118937155-118937177 GAGAAAGAATTTCAGGTAGTGGG + Intronic
914985604 1:152454728-152454750 GAAACAAAAGTTAAGTTACTTGG + Intergenic
915709961 1:157886114-157886136 TAGATAAAATTTCAGTCAGTGGG + Intronic
916092457 1:161318226-161318248 GATACAAAATGTCAGTTAGAAGG - Intronic
916097905 1:161367418-161367440 GAGAAAACATTTCACTTAACTGG - Exonic
917644096 1:177012964-177012986 GATCCAAAATTTTAGCTAATGGG - Intronic
917852037 1:179072921-179072943 GAGACAACTTTTTGGTTAATTGG - Exonic
917908532 1:179614984-179615006 GACACAAACTTTCAGTTAGGAGG - Intronic
917911967 1:179657960-179657982 GACACAAAATTTCAGTAGACAGG - Intronic
918361925 1:183768054-183768076 GAGAGAAAATTTGAGATATTGGG - Intronic
918553134 1:185767363-185767385 GAGTAAATATTTCAGTTAAATGG + Intronic
918667906 1:187175039-187175061 GACACAAAATTTAAGTTAGATGG + Intergenic
919870310 1:201815623-201815645 GATACAAAATTTCAGTTAGGAGG + Intronic
920153725 1:203931277-203931299 GATACAAATTTTCAGTTAGAAGG + Intergenic
920768810 1:208859843-208859865 GAAACAAAAGATCAGTTAAGAGG + Intergenic
920939867 1:210471930-210471952 GATACAAAATTTCAGTTAGAAGG - Intronic
921427195 1:215017618-215017640 GATACAAAATTTCAGTTAGGTGG + Intronic
921703886 1:218297794-218297816 GAGAAAAAATTCCAGCTATTTGG + Intronic
922506737 1:226130605-226130627 GATACAAAGTTTCAGTTAGAAGG - Intergenic
923348912 1:233084573-233084595 AAAACAAAATCTCTGTTAATGGG + Intronic
923839685 1:237655499-237655521 TAAACATAATTTCAGTCAATAGG - Intronic
924026989 1:239844177-239844199 GATACAAAATTTCTGTTAGGAGG - Intronic
1062992961 10:1837025-1837047 GATACAAAATGTCAGTTAGATGG - Intergenic
1063334234 10:5195804-5195826 GAGACAAGATTTCACTTGATTGG + Intronic
1063505568 10:6595147-6595169 GATACAAAATTTCAGATAGAGGG - Intergenic
1063747421 10:8900566-8900588 GATATAAAATTTTAATTAATTGG - Intergenic
1064590734 10:16888114-16888136 GATACAAAATTTCAGCTAGGAGG + Intronic
1065270987 10:24033823-24033845 TAGACAAAATGCCAGTGAATGGG - Intronic
1066020949 10:31301248-31301270 GATACAAAATTTCTGTTAGGAGG - Intergenic
1066161851 10:32741897-32741919 AATACAAAAGTTCAGTTCATAGG - Intronic
1066263512 10:33752392-33752414 GAGACGACATTTCAGCTGATAGG + Intergenic
1066332137 10:34435566-34435588 GATACAAGATTTCTGTTGATGGG - Intronic
1066388571 10:34960998-34961020 GGGACAAAAGTTCAGGTGATAGG - Intergenic
1066512023 10:36111036-36111058 GTGATAAAACTTGAGTTAATTGG + Intergenic
1067191819 10:44077043-44077065 GAAATAAAAATTCAGTGAATGGG - Intergenic
1068344973 10:55764334-55764356 GAAACAAAATTTCAGTTGACAGG - Intergenic
1068748533 10:60564085-60564107 GAGTCAAAATTTCAGTTTCATGG + Intronic
1069269241 10:66504160-66504182 GATACAAAATTTCAGTTAAATGG - Intronic
1069515763 10:69075757-69075779 TGGACAAGATTTCAGTTAAGAGG + Intergenic
1070165992 10:73898416-73898438 GTGACAAAATCTCAGCTAATCGG - Intergenic
1070209526 10:74301548-74301570 GAAATAACATTTCATTTAATTGG - Intronic
1070861600 10:79670627-79670649 GAAACAAAATTTCAGTTGACAGG + Intergenic
1071261336 10:83921996-83922018 GATACAAAATTTCAGTTAGATGG + Intergenic
1071402612 10:85290376-85290398 CAGACAACATTATAGTTAATGGG + Intergenic
1071642575 10:87327114-87327136 GAAACAAAATTTCAGTTGACAGG - Intergenic
1071743039 10:88383931-88383953 GTGATAACATTTCACTTAATTGG - Intronic
1071795110 10:88996480-88996502 GATACAAAATTTCAGTTAGGAGG + Intronic
1071798945 10:89036391-89036413 GAGACATAAATACAGTTCATGGG - Intergenic
1071954127 10:90738874-90738896 GAGACAGAAATTTATTTAATTGG - Intergenic
1072047138 10:91668270-91668292 GACACAAAATTTTAGTTAGGAGG - Intergenic
1073359264 10:102884346-102884368 GATACAAAATTTCAGTTATCAGG - Intronic
1074075728 10:110122544-110122566 GATACAAAATTTCAGTTAGGAGG - Intronic
1074600170 10:114905982-114906004 AAGACAGAATTTCAGAGAATTGG + Intergenic
1075019556 10:118941497-118941519 GACACAAACTTTCAGTTCATAGG + Intergenic
1075919063 10:126195132-126195154 GACACAAAATTTCGGTTAGGAGG + Intronic
1077725220 11:4667627-4667649 GGTACAAAATTTCAGTTATGTGG + Intergenic
1077935019 11:6774655-6774677 GATACAAAACTTCAGTTATACGG - Intergenic
1078445063 11:11397819-11397841 GATTCAAAATTGCAGTTGATTGG + Intronic
1080163418 11:29207166-29207188 GACACAAAATTTCAGTTAGATGG + Intergenic
1080167945 11:29262563-29262585 GAGAAGACATTACAGTTAATGGG - Intergenic
1080332734 11:31158479-31158501 AATACAATATTTCAGTTAAGAGG - Intronic
1081015404 11:37871828-37871850 GATATAAAATTTCAGTTAGATGG + Intergenic
1081283037 11:41234475-41234497 AATACAAAATTTCAGTTAGGAGG - Intronic
1081438443 11:43054343-43054365 CAGACAAGATTATAGTTAATGGG - Intergenic
1081913298 11:46714797-46714819 GAGAAAAAATTTCAGTCGAAAGG + Intergenic
1082971456 11:59026553-59026575 GACACAAAATTTCAGTTAGATGG - Intronic
1086442014 11:86837774-86837796 GAGAGAAAGTTTTAGTTAAATGG + Intronic
1086748734 11:90463216-90463238 GATACCAAATTTCAGTTAGAAGG + Intergenic
1087005879 11:93470938-93470960 AATACAAAATTTCAGTTAGGAGG - Intergenic
1087232146 11:95678018-95678040 AACACAAAATTTCAGTTAGGGGG + Intergenic
1088333234 11:108674838-108674860 CATACAAAATTTCAGTTAGAAGG - Intronic
1088512386 11:110591039-110591061 GATACAAAATTTCAGTTAGGAGG + Intronic
1088821266 11:113459673-113459695 GATACAAAAATTCAGTTAGATGG + Intronic
1088840278 11:113621283-113621305 CACACAAAATTTTTGTTAATGGG - Intergenic
1089687330 11:120163336-120163358 GAGACAGAATTTCAAGGAATTGG + Intronic
1090141460 11:124268785-124268807 GATAAAAAATTTCAGTTAGGAGG - Intergenic
1090884513 11:130864040-130864062 GACACAAAATTTCAGTTAGGAGG + Intergenic
1092663817 12:10771776-10771798 GAGACAAAACTCCTGTTGATTGG - Intergenic
1092665023 12:10786613-10786635 GGGACAAAGTTTCAGTTATGTGG - Intergenic
1093145885 12:15566705-15566727 GAGACGAAATTTCACTATATTGG + Intronic
1094366916 12:29693466-29693488 GATACAAAATTACAGTTAGGAGG - Intronic
1094722710 12:33080839-33080861 GACACAAAATTTCAGTTAGATGG - Intergenic
1094746924 12:33355379-33355401 GACACAAATTTTCACTTAAACGG - Intergenic
1095843472 12:46720379-46720401 GAGACAAAAGCTCACTTAGTGGG - Intergenic
1096746521 12:53731537-53731559 GAGACAACATTTCAGGGAAATGG - Intergenic
1097393436 12:59043862-59043884 GAGGCAGAATTTCAGTTTCTTGG + Intergenic
1097740398 12:63234914-63234936 GAGACAGAGTTTTAGTTATTTGG + Intergenic
1098182230 12:67860251-67860273 GAAAAAAAATTTCTGTTCATTGG - Intergenic
1098823707 12:75266963-75266985 GTTACAAAATTTTAGTTAAAAGG + Intergenic
1098994816 12:77106939-77106961 GGTACAAAATTTCAGTTAGATGG + Intergenic
1099140827 12:78973354-78973376 GAAACAAAATTTCAGTTAGAAGG - Intronic
1099692513 12:85976763-85976785 GAAACAAAAGTACAGTTATTAGG - Exonic
1100666114 12:96755427-96755449 GGTACAAAGTTTCAGTTAAATGG - Intronic
1101012408 12:100464571-100464593 GAGTCAAAAGTTCATTGAATTGG - Intergenic
1101466590 12:104956333-104956355 GGAAAAAAATTTCTGTTAATAGG - Intronic
1102611256 12:114114411-114114433 GAGACAATATTTAAGTTGACAGG - Intergenic
1103205122 12:119123057-119123079 GAGATAAAATATTAGTTGATTGG - Intronic
1105273206 13:18897165-18897187 GAAACAAAATTTATCTTAATGGG - Intergenic
1105358426 13:19682170-19682192 AAAATATAATTTCAGTTAATTGG + Intronic
1105604324 13:21914196-21914218 GAGTCAAAATATGAGTTAAAGGG - Intergenic
1106018441 13:25891655-25891677 TAGATAAATTATCAGTTAATAGG - Intronic
1106051805 13:26197530-26197552 GTGACAAAATTTCAAAAAATGGG - Intronic
1106497068 13:30288051-30288073 GGGACAATATTTCACTTAGTTGG + Intronic
1107408783 13:40139409-40139431 GAGACAGAATTACATTAAATTGG + Intergenic
1108180861 13:47838550-47838572 CAGAGAAAAATTCATTTAATTGG - Intergenic
1109116036 13:58386713-58386735 AACACAAAATTTCAGTTAAGAGG + Intergenic
1109179101 13:59191628-59191650 GATACAAAATTTCAGTTAGATGG - Intergenic
1109400125 13:61816218-61816240 GGGACAAAGTTTCAGTTAGACGG + Intergenic
1111229643 13:85327477-85327499 GACACAAAATTTCAGTTAGCAGG - Intergenic
1111453706 13:88452521-88452543 GATACAAAATTTCTGTTAGGAGG - Intergenic
1111653649 13:91126011-91126033 GACACAAAATTTCATTTAGGAGG - Intergenic
1111745094 13:92258174-92258196 AAGACAAAATTTAATTTATTTGG + Intronic
1111848380 13:93540786-93540808 GATACAAAATTATAGCTAATAGG - Intronic
1111891760 13:94091012-94091034 GTCACAAAATGTCAGTCAATGGG + Intronic
1112095894 13:96131654-96131676 GATACAAAATTTCAATTAGATGG - Intronic
1112317380 13:98375401-98375423 GAGGCAAAATTTTACTTTATGGG + Intronic
1112318131 13:98383034-98383056 GAAACAACATTTTAGTTAACTGG - Intronic
1112596895 13:100815764-100815786 GAGAAAAAAATTAAGTTAACTGG - Intergenic
1112678478 13:101733237-101733259 GAGAAAAAAAATTAGTTAATTGG + Intronic
1114052390 14:18931573-18931595 GAAACAAAGTTGCAGTTAGTTGG - Intergenic
1114054431 14:18954563-18954585 GAAACAAAGTTGCAGTTAGTTGG - Intergenic
1114108123 14:19447369-19447391 GAAACAAAGTTGCAGTTAGTTGG + Intergenic
1114110168 14:19470352-19470374 GAAACAAAGTTGCAGTTAGTTGG + Intergenic
1115141897 14:30181580-30181602 GAGAGAAATTGCCAGTTAATTGG + Intronic
1115197635 14:30818574-30818596 GACACAAAATTTCAATTAGGAGG + Intergenic
1115554997 14:34538447-34538469 GAAAAAGAGTTTCAGTTAATGGG - Intronic
1115669149 14:35589291-35589313 GACACAAAATTTAAGTTAGGAGG + Intronic
1116507360 14:45700737-45700759 GAGACAATATTGGAGGTAATAGG - Intergenic
1116907047 14:50414362-50414384 GATACAAAATTTCACTTAGGAGG - Intronic
1117691495 14:58311971-58311993 GATACAAAATTTCAGTTAGAAGG + Intronic
1118188708 14:63560675-63560697 GAGACAGGGTTTCAGTAAATTGG - Intergenic
1118200666 14:63669110-63669132 GATACAAAATTACAGTTAGGAGG - Intergenic
1118519750 14:66569899-66569921 GATACAAAATTTCTGCTAAAAGG - Intronic
1118575282 14:67236188-67236210 GATACAAAATTTCAGTTAGGAGG - Intergenic
1118978022 14:70694046-70694068 GAAAGATAATTTCAGGTAATGGG - Intergenic
1119272550 14:73321497-73321519 TAAACAAAATATCAGTTACTCGG - Intronic
1120506975 14:85365013-85365035 TAGACAAAATTTAAATGAATTGG - Intergenic
1120937949 14:89917205-89917227 GATACAAAATTTTAGTTACAGGG - Intronic
1121082880 14:91122793-91122815 GAGACAAAGTTTCACTATATTGG + Intronic
1122776983 14:104122276-104122298 GATTCAAAATTTCAGTTAGGAGG - Intergenic
1202833910 14_GL000009v2_random:63751-63773 GAGACAAGATTACATTTGATTGG + Intergenic
1123960850 15:25398411-25398433 GACACAAAATTTCAATTAAGAGG - Intronic
1124122602 15:26902823-26902845 GATAAAAACTTTCAGTAAATTGG - Intronic
1124503380 15:30250406-30250428 GATACACAATTTCAGTTAGGAGG + Intergenic
1124740175 15:32288233-32288255 GATACACAATTTCAGTTAGGAGG - Intergenic
1124872289 15:33555060-33555082 GAGAAAAAATTTCCTCTAATTGG - Intronic
1125244952 15:37624990-37625012 TAGACAAATTTTCAATTTATTGG - Intergenic
1125323118 15:38509821-38509843 GAGACAAAACCTCAGATAAGGGG + Intronic
1125396526 15:39254573-39254595 GATACAAAGTTTCAGTTAGGAGG + Exonic
1126748652 15:51852984-51853006 GAGACACAATTTCAATCAACTGG + Intronic
1126991331 15:54380085-54380107 GACACAAAATTTTAGTTAGAAGG - Intronic
1127219386 15:56861836-56861858 GATACAAAATTTCAGTTAGGAGG + Intronic
1127730098 15:61792437-61792459 GATACAAAATTTCTGTTAGATGG - Intergenic
1128252832 15:66175056-66175078 GATAAAAAAATTCAGTAAATTGG - Intronic
1129531947 15:76273777-76273799 GATACAGATTTTCAGTGAATAGG - Intronic
1131322637 15:91409677-91409699 AAGATAAAATTCCTGTTAATGGG + Intergenic
1131327041 15:91457849-91457871 AACACAAAATTTCAGTTAGATGG - Intergenic
1131498678 15:92938277-92938299 GGGATAACATTTCACTTAATTGG - Intronic
1132003721 15:98206820-98206842 CATACAAAATTTCAGTTAGATGG + Intergenic
1134378134 16:13698686-13698708 GAGTCAATATTTCACTTTATTGG + Intergenic
1134475867 16:14573417-14573439 GACACAAAATTTCAGTTAGTAGG - Intronic
1134515098 16:14880566-14880588 GAGACAAGATTTCACTTTGTTGG + Intronic
1134702774 16:16279213-16279235 GAGACAAGATTTCACTTTGTTGG + Intronic
1134964769 16:18432902-18432924 GAGACAAGATTTCACTTTGTTGG - Intronic
1134969056 16:18515437-18515459 GAGACAAGATTTCACTTTGTTGG - Intronic
1135280065 16:21146694-21146716 GATATAAAATTTCAGTTAGATGG - Intronic
1135774919 16:25249173-25249195 GGTACAAAATTTCAGTTAGATGG + Intronic
1137258262 16:46796461-46796483 GAAACAAACTTTCAGTTAGGAGG + Intergenic
1138756579 16:59493788-59493810 GATACAGAAATTCAGTTAAAGGG - Intergenic
1139758685 16:69166529-69166551 GAGACAAAATATCATTTCTTTGG + Intronic
1140579966 16:76218428-76218450 TGGACAAAATTTCAGTTAGGAGG - Intergenic
1140595278 16:76401652-76401674 CAGACAACATTACAGTGAATGGG - Intronic
1140912049 16:79463019-79463041 GAGTGAATATTTCAGTCAATGGG + Intergenic
1141339370 16:83188701-83188723 TACACAAAATTTGAGTTTATAGG - Intronic
1142737838 17:1912813-1912835 GATCCAAAATTACAGTTACTCGG + Intergenic
1145096848 17:20036652-20036674 GATACCAAATTTCAGTTAGGAGG - Intronic
1146004315 17:29151233-29151255 CAGAAAAAATTCCAGTTAAATGG + Intronic
1148571742 17:48675417-48675439 GAGACAGAATCTCATTTTATTGG - Intergenic
1149019459 17:51946182-51946204 GATATAAAATTTCAGTTAAGTGG + Intronic
1150053431 17:61988918-61988940 GACACAAAATTTCAGTTGGGAGG - Intronic
1150954245 17:69838657-69838679 GATACAAAATTTCAGTTAGAAGG + Intergenic
1151041743 17:70869758-70869780 GAGACAAAATTAAAATTAGTGGG - Intergenic
1153698953 18:7673163-7673185 GAGACAACCTGTCAGTTCATAGG - Intronic
1154464974 18:14634734-14634756 GAAACAAAATTTATCTTAATGGG - Intergenic
1154965945 18:21356287-21356309 CACACAAAATTTCAGTTAGAAGG - Intronic
1154976801 18:21465207-21465229 GACACAAAATTTCAGTTAGGAGG - Intronic
1155561745 18:27085746-27085768 GACCCAGCATTTCAGTTAATAGG + Intronic
1155885329 18:31200680-31200702 GATACAAAATTTCAGTTAGAAGG - Intergenic
1156146949 18:34194106-34194128 GATACAAAATTTCACTTAGGAGG + Intronic
1156257556 18:35411951-35411973 TGGACAAAATTGTAGTTAATAGG + Intergenic
1156363897 18:36408313-36408335 GAGACACAGTCTCAGTTAGTGGG + Intronic
1157241836 18:46017864-46017886 GATACAAAATTTCGGTTAGGAGG - Intronic
1157247733 18:46069250-46069272 GAGAAAAAATTCCAGTTTTTGGG - Intronic
1157918453 18:51692619-51692641 GAGAGAAAATTACAATTTATTGG - Intergenic
1158075558 18:53524022-53524044 GGTACAAAATTTCAGTTAGGAGG + Intronic
1158313218 18:56181647-56181669 AATACAAAATTTCAGTTAGGAGG + Intergenic
1158538236 18:58327784-58327806 GTGACATAATTTTTGTTAATGGG + Intronic
1158743993 18:60176513-60176535 GATACAAAATTTCAGTTAAGGGG + Intergenic
1158906349 18:62016817-62016839 GATACAAAACTTCAGTTAGGAGG - Intergenic
1159225420 18:65527998-65528020 GAGACTAAATTTCAGAAAAGTGG + Intergenic
1159327522 18:66942243-66942265 AAGATTACATTTCAGTTAATTGG - Intergenic
1159336192 18:67070332-67070354 GAGATAAACTTTATGTTAATAGG - Intergenic
1159820363 18:73133878-73133900 GAGGCAAAATTCCTGTTTATAGG - Intergenic
1162815192 19:13189886-13189908 GAAAGAAAATTCCAGTTAGTGGG - Intergenic
1163316628 19:16544895-16544917 GGGATAACATTTCACTTAATTGG + Intronic
1163937430 19:20460912-20460934 GAGACATAATTTCAATAAAAAGG - Intergenic
1165280080 19:34789046-34789068 GATACAAAATTTCAGTTAGCAGG - Intergenic
1166165301 19:40983696-40983718 GATACAAAATGTCAGTTAGGAGG + Intergenic
1168086252 19:54049452-54049474 GATACAAAATGCCAGTGAATTGG + Intronic
1202638774 1_KI270706v1_random:63941-63963 GAGACAAGATTACATTTGATTGG - Intergenic
925358979 2:3264100-3264122 GATACAAAGTTTCAGTTAAGGGG - Intronic
925494637 2:4433262-4433284 AATACAAAATTTCAGTTACAAGG - Intergenic
925564784 2:5238911-5238933 CATACAAAATTTTAGTGAATTGG + Intergenic
925677559 2:6381050-6381072 GAGACAATCTTTCATTTAAATGG + Intergenic
926032463 2:9603938-9603960 AAGACAAAGTTTTAGTTTATGGG - Intronic
926262430 2:11278190-11278212 GATACAACATTTCAGTTAGATGG - Intronic
926428436 2:12761620-12761642 GAAACAGAATTTAGGTTAATTGG - Intergenic
928184415 2:29096703-29096725 GAAAGAAAATTCCAGTTATTAGG - Intergenic
928338421 2:30418990-30419012 GACACAAAATTTCAGTTAGGAGG + Intergenic
929090439 2:38211468-38211490 GAGAAAAAAAATCAGTGAATTGG + Intergenic
929180427 2:39032239-39032261 GACACAAAATTTCAGTTAGGAGG - Intronic
929193324 2:39160363-39160385 GATACAGAATTTCAGTTAGAAGG + Intergenic
929473939 2:42226289-42226311 GACACAAAATTTCAGTTAGATGG + Intronic
929771664 2:44897537-44897559 GAGTCAAAAGTTAAGTTCATGGG - Intergenic
930561446 2:52964461-52964483 GAGACAGGGTTTCACTTAATTGG - Intergenic
931204900 2:60137540-60137562 TGGACCAAAATTCAGTTAATAGG - Intergenic
931680453 2:64743101-64743123 AAAACAAAATTTCATTTAAATGG - Intronic
932751634 2:74375025-74375047 GAGACAGAAGTGGAGTTAATGGG - Intronic
933185499 2:79274367-79274389 GAGACAAAATATAAGATAGTGGG - Intronic
933479398 2:82836251-82836273 GATACAAAATTACAGTTAGATGG - Intergenic
933804126 2:85985805-85985827 GACACAAAAGTTCAGTTAGGAGG + Intergenic
934874228 2:97900291-97900313 GACACAAAATTTCAGTTAGAAGG - Intronic
935226714 2:101059310-101059332 GAGCCAAAAGTTCAGTTAGTAGG + Intronic
935290661 2:101608193-101608215 GAGAAAAAATTTCAAGGAATGGG + Intergenic
936910542 2:117587407-117587429 GATATAAAATTTCAGTTAGGAGG + Intergenic
937639891 2:124199942-124199964 GAAAGAAAATTTCTGTTGATTGG - Intronic
938326382 2:130407539-130407561 GACAGAAAATTTCAGTTGACAGG + Intergenic
938363556 2:130713920-130713942 GACAGAAAATTTCAGTTGACAGG - Intergenic
938472448 2:131577327-131577349 GAAACAAAGTTGCAGTTAGTTGG - Intergenic
939760748 2:146174778-146174800 GAGCAAAAATTATAGTTAATTGG + Intergenic
941219391 2:162756912-162756934 ATCACAAAATTTAAGTTAATAGG + Intronic
941256295 2:163235585-163235607 GATACAAAATTTTAGTTAGGAGG - Intergenic
941477350 2:165966440-165966462 AAGACAAAATCTCAGATAAATGG + Intergenic
941546750 2:166860402-166860424 AACACAAAATTTCAGTTAGGAGG + Intergenic
941821716 2:169850363-169850385 GAGACAAAGTCTCACTTTATTGG + Intronic
942935537 2:181552180-181552202 GATATAAAATTTCAGGTAAAAGG + Intronic
942992541 2:182218514-182218536 GATACATAATTTCAGTTAGATGG - Intronic
943362460 2:186937503-186937525 CAGACAGCATTTCAGTTCATCGG - Intergenic
944095376 2:195961345-195961367 GATAAAAAATTTCAGTTAGGAGG - Intronic
944261622 2:197684244-197684266 GATACAAAATTTCAGCTAGATGG + Intergenic
944274137 2:197816848-197816870 CAGACAGAATTTCAGTTTAATGG - Intronic
944531002 2:200667775-200667797 GAGACAAGACTTCACTTAGTGGG + Intronic
944762748 2:202833948-202833970 GACACAAAATTTCAGTTAGGAGG + Intronic
944773145 2:202933808-202933830 GATACAAAATTTCAATTACGAGG - Intronic
945522942 2:210851566-210851588 TATACAAAATGTCAGTTATTTGG + Intergenic
946517953 2:220433910-220433932 CAGGCAAAACTTCAGCTAATGGG + Intergenic
946809585 2:223509445-223509467 GAGACAAAAAGTCAATTGATAGG - Intergenic
946819323 2:223613906-223613928 GAGACAGAGAGTCAGTTAATGGG + Intergenic
947114538 2:226754786-226754808 AAAACAACATTTCACTTAATAGG + Intronic
947320188 2:228908593-228908615 GATACAAAATTTCAGTTAGCAGG + Intronic
947361756 2:229352622-229352644 TAGAAAATATTTCACTTAATTGG + Intergenic
1169424223 20:5483950-5483972 GAGTGAAAATCTCATTTAATCGG + Intergenic
1170063524 20:12285809-12285831 GAGACAAACTTACAGATAACAGG - Intergenic
1170464477 20:16610356-16610378 GAGACAAAGTTTCACCTTATTGG - Intergenic
1173323111 20:42007403-42007425 GAGTCAACATTTCAGGTCATAGG - Intergenic
1173961938 20:47080531-47080553 GATACAAAATTTCAGTTAATAGG + Intronic
1175614406 20:60382085-60382107 GAAACAAAATTTCAATTTGTTGG + Intergenic
1176809564 21:13523651-13523673 GAAACAAAATTTATCTTAATGGG + Intergenic
1177032847 21:16004214-16004236 GAGCCAAAATTTTAGTCAACCGG + Intergenic
1177405813 21:20666635-20666657 GGGACAAAGTTGCAGTTAAGAGG + Intergenic
1177549573 21:22602117-22602139 GACACTTCATTTCAGTTAATGGG + Intergenic
1177628243 21:23692901-23692923 GATACAAAATTTCAGTTAGACGG - Intergenic
1179428126 21:41297945-41297967 GATACAAAATTTCAGTTAGGAGG + Intergenic
1180363193 22:11917948-11917970 GAGACAAGATTACATTTGATTGG + Intergenic
1180470864 22:15653948-15653970 GAAACAAAGTTGCAGTTAGTTGG - Intergenic
1180472902 22:15676939-15676961 GAAACAAAGTTGCAGTTAGTTGG - Intergenic
1182027737 22:27133741-27133763 GAGAAAAAAGTTAAGTTCATTGG - Intergenic
1182682038 22:32087131-32087153 GATACAAAATTTCAGTTAAGAGG + Intronic
1183537059 22:38408954-38408976 GATACAAAATTTCAGTTAGATGG + Intergenic
1185321890 22:50205116-50205138 GGGACAAAGTTTCAGTTTCTGGG + Intronic
949595488 3:5540211-5540233 GATACAAAATTTCAGTTAGGAGG - Intergenic
949603308 3:5625662-5625684 GATACAAAATTTTAGTTAGACGG - Intergenic
949631056 3:5927031-5927053 GAGAAGAGATTTCAGTTAATGGG + Intergenic
949867857 3:8561446-8561468 GAGAAAACATTTCACTGAATTGG + Intronic
951504979 3:23435364-23435386 GAGATAAAAGTTAAGTTACTTGG + Intronic
951874633 3:27408468-27408490 GAAAGAAAATTTCAGTTGTTAGG + Intronic
952697591 3:36287098-36287120 GATACAAAATTACAGCTAATGGG + Intergenic
954120240 3:48494073-48494095 GACACAAAATTTCACTTAGGAGG - Intronic
954611876 3:51948637-51948659 AATACAAAATTTCAGTTAGGAGG - Exonic
955140635 3:56265840-56265862 GAGACAAGATTTCAGTATGTTGG - Intronic
955720560 3:61875929-61875951 GAGACTAGATTTCAGTTATAAGG - Intronic
956565677 3:70634992-70635014 GACACAAAATTTCACTTAGGAGG + Intergenic
957359475 3:79135148-79135170 GACATAAAATTTCAGTTAGGAGG - Intronic
958256204 3:91328330-91328352 GACACAAAATTTCAGTGAAGAGG - Intergenic
958498553 3:94875789-94875811 GACACAAACTTTCTGCTAATTGG + Intergenic
959697177 3:109261140-109261162 GAGACAGAATTTCAGTAAACAGG - Intergenic
959926813 3:111931334-111931356 GAAACAAAACTTCAGTTTTTTGG - Intronic
961126714 3:124425165-124425187 GGGACAAAATTACAGTTAGAAGG + Intronic
962486049 3:135843376-135843398 GATATAAAATTTCCGTTAAAGGG + Intergenic
962674076 3:137740264-137740286 GATACAAAATTTCAGTTAGAAGG - Intergenic
963548241 3:146687870-146687892 GGTACAAAGTTTCAATTAATTGG - Intergenic
964301110 3:155285942-155285964 GATACAAAATTTTAGTTAGACGG + Intergenic
965312154 3:167141997-167142019 GATACAAAGTTTCAGTTAGCTGG + Intergenic
965368120 3:167824577-167824599 AAAACAAAATTTTATTTAATAGG + Intronic
965593497 3:170384848-170384870 GAGCTAAATTTTCAGATAATTGG + Intronic
965875254 3:173309833-173309855 GAATCAATATTTCAGTGAATGGG + Intergenic
966517896 3:180839424-180839446 GACACAAAATTTCAGTTAGGAGG - Intronic
966973251 3:185064501-185064523 GACACAAAATTTCATTTAGGAGG + Intergenic
967002163 3:185346122-185346144 GATACAAAATTTCAGTTAGAAGG - Intronic
967649354 3:191966560-191966582 GAGACATACTATCAGTTAATTGG + Intergenic
967702886 3:192614734-192614756 GAGACAGAGTTTCAGGTAACTGG + Intronic
970826990 4:20287993-20288015 GAAACAAAATTTCAGTAACATGG + Intronic
971221683 4:24713663-24713685 GGTACAAAGTTTCAGTTATTTGG - Intergenic
971286754 4:25297473-25297495 GACACAAAATTTCAGTTAGATGG - Intergenic
971572773 4:28234455-28234477 GAGACAAATTATCAGTAAAGTGG - Intergenic
971928017 4:33039234-33039256 CAGATAAAATTTCAGATATTAGG - Intergenic
972005679 4:34100936-34100958 GATACAAAATTGCAGTTAAGAGG + Intergenic
972263620 4:37437479-37437501 GACACAAACATTCAGTTTATAGG + Intronic
972283598 4:37626902-37626924 GACACAAAATTTTAGTTAGAGGG + Intronic
972754497 4:42031671-42031693 GATAAAATATTTCACTTAATTGG - Intronic
972786578 4:42331991-42332013 GAGACAAAAGTTCAGGTTTTGGG - Intergenic
974274443 4:59699581-59699603 GAGGCAAATTTTCAGTTTGTAGG + Intergenic
974736305 4:65937786-65937808 GTTACAAAATTTCAGTTAGAAGG - Intergenic
975309640 4:72889067-72889089 GATACAAAATTTCAGTCAGGAGG + Intergenic
975634534 4:76433865-76433887 TATACAAAATTTCAGTTAGGAGG - Intergenic
975857090 4:78636275-78636297 GTGACAAAAATACAGTTAACAGG - Intergenic
975955533 4:79833054-79833076 GATACAAAATTTTAGTTACAAGG + Intergenic
976886687 4:89993562-89993584 GAGAAGAAATTTGCGTTAATTGG - Intergenic
977053298 4:92157275-92157297 GATACATAATTACAGTTTATAGG + Intergenic
977804276 4:101278336-101278358 GAGGCAAAATTTGGGGTAATGGG - Intronic
978009825 4:103666849-103666871 GACACAAAATGTCAGTAAACTGG - Intronic
978063218 4:104364415-104364437 GAGACAAGGTTTCAGCCAATGGG + Intergenic
978718250 4:111872446-111872468 GAGACAAAAGCTCAATCAATCGG + Intergenic
978877180 4:113655670-113655692 GAGACAACTTTGCAGTTCATGGG - Intronic
979172449 4:117618969-117618991 GATACAAAATTTTAGTTAGAAGG + Intergenic
979679177 4:123440746-123440768 GAGAGTAAATTCCAGTTATTTGG + Intergenic
980021554 4:127716237-127716259 GAAACAAAAATTAAATTAATTGG + Intronic
981113834 4:140966895-140966917 GAGAAAACATGTCCGTTAATAGG + Intronic
981575493 4:146200078-146200100 GGTACAAAATTTCAGTTAGGAGG + Intergenic
981691147 4:147510565-147510587 TAGAAAAAATATCAGTTAAGTGG - Intronic
981891572 4:149744682-149744704 GACACAAAATATCAGCAAATGGG + Intergenic
981956907 4:150486746-150486768 GATACAAAATTTTAGTTAGGAGG - Intronic
982420231 4:155186699-155186721 GACACAAAATTTCGGTTAGGAGG - Intergenic
982534322 4:156589721-156589743 GAGACAAACATTCAGTTATAAGG + Intergenic
983197923 4:164828183-164828205 TGGACAAAATTTCATTTATTAGG + Intergenic
983280164 4:165670755-165670777 TAGACAAGAGTTAAGTTAATGGG + Intergenic
983312578 4:166083491-166083513 AATACAAAATTTCAGTTAGATGG - Intronic
983391589 4:167138318-167138340 GTGACAAAAATTCAGTAAATAGG - Intronic
983797372 4:171881536-171881558 GAGACAACATTTGAGTCAGTGGG - Intronic
983855810 4:172642598-172642620 AATACAAAATTTCAGTTAGGAGG + Intronic
1202766112 4_GL000008v2_random:149800-149822 GAGACAAGATTACATTTGATTGG - Intergenic
986143761 5:5057074-5057096 AAGACAAAAATTGATTTAATTGG + Intergenic
987267161 5:16267929-16267951 GATACAAAATTTCAGTTCCTTGG + Intergenic
987472797 5:18353444-18353466 GATACAACATTTCAGTTAGGAGG - Intergenic
987943703 5:24575979-24576001 GAGTCAATATTTCAGACAATAGG - Intronic
987963458 5:24840905-24840927 CAGATAAATTTTCATTTAATGGG + Intergenic
988023817 5:25657281-25657303 AATACAAAATTTCAGTTAGCTGG - Intergenic
988226266 5:28415048-28415070 GAGACAAAATTTCAGTAAGGAGG + Intergenic
988690376 5:33566065-33566087 TAGAGACAATTTCAGTTCATAGG + Intronic
990249438 5:53897936-53897958 TATACAAAATTTATGTTAATTGG - Intronic
991707812 5:69375997-69376019 GATTCAAAATTTCAGGTTATAGG - Intronic
991990464 5:72333637-72333659 GATACAAAATTTCAGTAAGATGG + Intronic
992399079 5:76395171-76395193 GAGGCAAAATGGCAGTTAATTGG + Intergenic
992419298 5:76585976-76585998 GGGAAAAAATTCCAGTTAAAAGG - Intronic
992433024 5:76728294-76728316 GGTACAAAATTTCTGTTAAAAGG - Intronic
994157419 5:96519506-96519528 GCGACAAACTTTCAATTAAAAGG - Intergenic
994430371 5:99651390-99651412 GATACAAAATTTCAGTGAGATGG + Intergenic
995318607 5:110804845-110804867 GAGAAAACATTACAGTTAAAAGG - Intergenic
995622751 5:114045173-114045195 GACACAAAATTTCAGTTAGATGG - Intergenic
996268113 5:121567922-121567944 GATACAAAATTTCACTTATATGG + Intergenic
996452266 5:123638752-123638774 GATACAAAATTACAGTTAGGAGG + Intergenic
997107686 5:131039756-131039778 GAAAGACAAATTCAGTTAATTGG + Intergenic
997253930 5:132412040-132412062 GAGACAAAAATTGAGTTAAAGGG - Intronic
997356853 5:133267996-133268018 AAGGTAAAATTTCAGTTAAATGG - Intronic
997630359 5:135363463-135363485 GAGACATGATTTCAGACAATAGG - Intronic
998099343 5:139419143-139419165 GAGCCAAAACTTCAGTTAAAAGG + Intronic
998629246 5:143880281-143880303 GAGAGAAAATTTCTTTGAATTGG + Intergenic
998920953 5:147067277-147067299 GATACAAAATTTCAGATAGGAGG - Intronic
999764363 5:154727530-154727552 GCTACAAAATTTCAGTTAGATGG + Intronic
1000488789 5:161882795-161882817 GAGAGAACATTTCACTAAATTGG + Intronic
1000699067 5:164425419-164425441 GATACAAAATTTCAGTTAGGAGG + Intergenic
1002665564 5:180821406-180821428 GACACAATGTTTCAGTAAATTGG - Intergenic
1003458153 6:6303644-6303666 AATACAAAATTTCAGTTAGATGG - Intronic
1003588103 6:7411989-7412011 CAGATAATATTTCACTTAATTGG + Intronic
1003968402 6:11275287-11275309 GATACAAAATTTCAGTTAGGAGG + Intronic
1004794972 6:19071452-19071474 GACTAAATATTTCAGTTAATAGG + Intergenic
1005268552 6:24139071-24139093 GATACAAAATTTCAACTAAGAGG - Intronic
1005769807 6:29056916-29056938 GATACAAAATTTCAGTTAGGAGG - Intergenic
1006959214 6:37910682-37910704 GACATAAAATTTCAGTTAGGAGG - Intronic
1008147426 6:47908355-47908377 GAGACAAAATCCCAATTCATGGG - Intronic
1008905845 6:56676921-56676943 GATGCAAAATTTCAGTTAAGAGG + Intronic
1008999129 6:57692837-57692859 GATACAAAATTTCAGTGAAGAGG + Intergenic
1009187622 6:60592216-60592238 GATACAAAATTTCAGTGAAGAGG + Intergenic
1009307188 6:62105356-62105378 TAAACAAAATTTTAGTTAATAGG + Intronic
1010127998 6:72456470-72456492 GAGACAAAATTACAGATAGAAGG - Intergenic
1010252278 6:73720386-73720408 GACACAAAATTTCAGTTATACGG + Intronic
1010473112 6:76253403-76253425 GATGCAAAATTTCAGTTAAGAGG + Intergenic
1010747032 6:79575241-79575263 GACACAAAATTTCAGTTAGGTGG - Intergenic
1010863680 6:80945569-80945591 GACTCAAAATTTCAGTTAAGCGG + Intergenic
1011501046 6:87990234-87990256 GGTACAAAGTTTCAGTTAGTAGG + Intergenic
1012135512 6:95551574-95551596 AAGAAAAAACTTCAATTAATGGG - Intergenic
1012230649 6:96757296-96757318 GTCACAAAATTTCAGTTCAGAGG + Intergenic
1012478766 6:99644209-99644231 GATACACAATTTCAGTTAGGAGG + Intergenic
1012601299 6:101100752-101100774 GATACAAAATTTCAGTTAGATGG - Intergenic
1012980809 6:105828842-105828864 GATACAAAATTTCAGTTAGGAGG + Intergenic
1013150008 6:107436617-107436639 GATACAAAATTTCAGTTGGGAGG + Intronic
1013690608 6:112637661-112637683 GAGTCAAAATTTCAAAGAATGGG + Intergenic
1013988609 6:116227086-116227108 GACACAAAATTTCAGGTAGGAGG - Intronic
1014031996 6:116716696-116716718 GAGGCAAAATATCAGTAGATAGG - Intronic
1015047747 6:128797489-128797511 GATAAAAACTTTCAGTTAATTGG + Intergenic
1015187862 6:130439082-130439104 GAGACAAAGTTAAAGTCAATGGG + Exonic
1015392116 6:132694521-132694543 TAGACAAAATTTTAGTAAACGGG - Intronic
1015876990 6:137832683-137832705 GAGCCAAAAATTGAGGTAATTGG - Intergenic
1015964647 6:138686058-138686080 GATACAAAATTTCTGTTAAGAGG + Intronic
1016271844 6:142299498-142299520 GATACAAAGTTTCAGTTAGAAGG + Intergenic
1016574811 6:145557840-145557862 GATACAAAATTTTAGTTAGGAGG - Intronic
1016876732 6:148873054-148873076 TAAACATAATTTCAGTTGATGGG - Intronic
1017685845 6:156913592-156913614 GATACAAAATTTCAGTTAGATGG - Intronic
1018684821 6:166296115-166296137 GAGAAAAAATTTCAAGTACTTGG - Intergenic
1019829584 7:3313698-3313720 GATACAAAATTTCATTTAGAAGG + Intronic
1019875262 7:3804911-3804933 GACACAAAATTTTAGTTAGAAGG + Intronic
1020346617 7:7172212-7172234 GATATAAAATTTCAGTTAATAGG + Intronic
1020516738 7:9131088-9131110 GGTACAAAATTTCAGTTAGATGG - Intergenic
1020830965 7:13095120-13095142 GATACAAAATTTCAGTTAGAAGG + Intergenic
1020971122 7:14940457-14940479 GGGATAACATTTCACTTAATTGG + Intronic
1021208548 7:17814506-17814528 GAGAGAAAATGTCATTTACTTGG - Intronic
1021532405 7:21662711-21662733 GACACAAAATTTCAGTTGGGAGG - Intronic
1021634806 7:22681836-22681858 GCTACAAAATTTCAGTTACGAGG - Intergenic
1022312212 7:29208106-29208128 TAGATAAACTTTCTGTTAATTGG + Intronic
1022825776 7:34011888-34011910 GAAACAAAATTTCGGAAAATGGG - Intronic
1023292717 7:38685150-38685172 GATACAAAATTTCAGTTAGGAGG + Intergenic
1023460808 7:40394633-40394655 GATACAAAATTTTAGTTAGAAGG - Intronic
1023490110 7:40730648-40730670 GACACAAAATTTCAGTTAGGAGG - Intronic
1024682859 7:51712017-51712039 GTGATGTAATTTCAGTTAATTGG + Intergenic
1026168263 7:67930547-67930569 AAGACATAATTTAAGCTAATTGG + Intergenic
1026176311 7:68000803-68000825 GATACAACATATGAGTTAATTGG - Intergenic
1027825944 7:83116738-83116760 GATACAAAATTTCAGTTAGAAGG - Intronic
1027990784 7:85358384-85358406 GAAGCAAAATATCACTTAATAGG + Intergenic
1028175676 7:87655597-87655619 GATATAAAAATTCAGTTAAAAGG + Intronic
1028335511 7:89649222-89649244 AACACAAAATTTCAGTTAGATGG - Intergenic
1028405607 7:90470485-90470507 GAGACAGAATTTGAATTACTTGG + Intronic
1028533437 7:91864170-91864192 GATACAAAATTTCAATTAGACGG + Intronic
1029035314 7:97513691-97513713 GAAACAAAATTTCAGTCCACTGG - Intergenic
1029940244 7:104472684-104472706 GAGACAGAATTTTACTTAAATGG - Intronic
1030576414 7:111291640-111291662 GGTACAAAATTTCAGTTAGAGGG + Intronic
1030636917 7:111960654-111960676 GATACAAAATTTCAGTTAGGAGG - Intronic
1030711611 7:112756802-112756824 TAGTCAAAATTTCAGAAAATAGG + Intergenic
1031356326 7:120791364-120791386 GATACAAAATTTCAGTTAGGAGG + Intronic
1031435684 7:121729217-121729239 GAGAGATGATTTCAGGTAATCGG - Intergenic
1031729420 7:125279789-125279811 GAGAGAAAATTACAGTCATTAGG - Intergenic
1031828318 7:126594612-126594634 GATACAAAATTTCACTTAGGAGG + Intronic
1033326979 7:140388048-140388070 GATACAAAATTTCAGTTAGGAGG - Intronic
1033901854 7:146152403-146152425 GATACAAAATTTCAGTTAGATGG + Intronic
1033970741 7:147035442-147035464 GAAATAAAATTTCAATTAAAGGG + Intronic
1035128043 7:156624748-156624770 GATGCAAAATTTCAGTTAATAGG + Intergenic
1035632961 8:1121991-1122013 CATACAGAATTTCATTTAATGGG + Intergenic
1036007164 8:4678853-4678875 ATGACAGAATTTCAGTTACTGGG - Intronic
1036481379 8:9142622-9142644 GATACAAAATTTCAGGTAGACGG - Intronic
1037026824 8:14049242-14049264 GAGATAAAATTTCAATTAACTGG - Intergenic
1037333306 8:17766117-17766139 GTGACAAAAATTCACTAAATCGG - Intronic
1037441060 8:18916613-18916635 GGAACAAAATTTCAGTTAGATGG + Intronic
1038708279 8:29917116-29917138 CAGTCAAAATCACAGTTAATGGG + Intergenic
1038722293 8:30047738-30047760 GATTCAAAATTTTAGTCAATGGG + Intergenic
1038921639 8:32091514-32091536 GAAATAAGATTTTAGTTAATTGG + Intronic
1038966442 8:32578180-32578202 GAGACAAGATTTCAGTATGTTGG + Intronic
1041207704 8:55514861-55514883 GAGAAAAAAATTCTGTAAATGGG - Intronic
1041211263 8:55553331-55553353 GAGACAAAATTTCAGATTTGTGG - Intergenic
1041407831 8:57519734-57519756 GATACAAAATTTCAGTTTAGGGG - Intergenic
1042055088 8:64755856-64755878 GAGTCAACATTTCACTTAATTGG + Intronic
1042491374 8:69402326-69402348 AAGACAAGATTACAGTTGATTGG + Intergenic
1042803721 8:72748960-72748982 GGTACAAAATTTCAGTTAGACGG - Intronic
1042974905 8:74457730-74457752 TAGAGAAAATTTCAGCTACTTGG + Intronic
1044758798 8:95494782-95494804 GATACAAAATTTCAGTTAGAGGG + Intergenic
1045014755 8:97991224-97991246 GAAACAAAAATTCAGTTACTGGG - Intronic
1045132268 8:99166330-99166352 GGGACAACATTTCACCTAATTGG + Intronic
1045576242 8:103423569-103423591 GAGACAAAATTTCAAATAGATGG + Intronic
1045598633 8:103687622-103687644 GATACAAAATTTCAGTTAGATGG - Intronic
1045642139 8:104262417-104262439 CAGACCAAATTCCAGTTAAGGGG - Intergenic
1045712764 8:105004682-105004704 GAAACAAAATTTCTGCCAATTGG - Intronic
1045784466 8:105904188-105904210 GAGACAAGATTTCAGTGAAAGGG - Intergenic
1045985384 8:108244205-108244227 GAGAAATTATTTCACTTAATTGG + Intronic
1047023260 8:120799660-120799682 GAGTCCAATGTTCAGTTAATAGG + Intronic
1047057359 8:121180754-121180776 GACACAAAATTTCACTTAGGAGG + Intergenic
1047824488 8:128558799-128558821 GACACAAATTTTCAGTTAGGAGG + Intergenic
1047927115 8:129692850-129692872 GATACAAAACATCCGTTAATGGG - Intergenic
1047949618 8:129920900-129920922 GAGACAAAATTTTAGTCATTTGG + Intronic
1049961134 9:739354-739376 AAGACAGAATTTCAGAAAATTGG - Intronic
1050497256 9:6256942-6256964 GACATAAAATTTCACTTATTAGG + Exonic
1051244064 9:15091465-15091487 GACACAAACATTCAGTTTATAGG - Intergenic
1051255884 9:15212859-15212881 GATACAAAAATACAGTTAAATGG + Intronic
1051572679 9:18578209-18578231 TAGACAAAATCTCAGCTCATGGG - Intronic
1052178547 9:25496207-25496229 CATACAAAATTTCATCTAATGGG + Intergenic
1052296446 9:26901102-26901124 GAAACAAGCTTTCAGTTTATAGG + Intergenic
1052470868 9:28894953-28894975 GATACAAAATTTCAGTTAGGAGG - Intergenic
1052798293 9:32944410-32944432 GATACAAAATTTCAGTTAGGAGG - Intergenic
1054720448 9:68598325-68598347 GAGACAAAGTTTCAGCTTGTTGG + Intergenic
1056252529 9:84764543-84764565 GAAAAAAAGTTACAGTTAATAGG + Intronic
1056506367 9:87261891-87261913 GGTACAAAATTTCAGTTAACAGG - Intergenic
1057027759 9:91747954-91747976 GATACAAAATTTCAGTTAGAAGG + Intronic
1058067930 9:100569893-100569915 GATACTAAATTTCAGTTAGATGG - Intronic
1058320433 9:103623303-103623325 GATACAAAATTTCAGTTAGAAGG + Intergenic
1058829497 9:108802756-108802778 GAGACTATATTTCAGCTATTAGG + Intergenic
1058925417 9:109658304-109658326 GAGACAAGATTCAAGTTGATAGG + Intronic
1059128095 9:111713952-111713974 TAGACAAAATTTCTGACAATTGG + Intronic
1203546859 Un_KI270743v1:134689-134711 GAGACAAGATTACATTTGATTGG - Intergenic
1185923176 X:4116468-4116490 GATACAAAATTTCACTTAGGAGG + Intergenic
1185946027 X:4377147-4377169 GATACAAAAGTTTAGTTAAATGG - Intergenic
1186343951 X:8672018-8672040 GATACAAAATTTCAGTTAGGAGG - Intronic
1186650327 X:11552858-11552880 GATACAAAATTTCAGTTAGGAGG + Intronic
1187780027 X:22810434-22810456 GATACAAAATTTCAATTAGATGG + Intergenic
1188248554 X:27863383-27863405 GGTACAAAATTTCAGTTAGATGG + Intergenic
1188460714 X:30423718-30423740 GATTCAAAATTTCAGTTAGGAGG + Intergenic
1188666388 X:32826731-32826753 GATACTAAATTACATTTAATAGG + Intronic
1188863611 X:35287152-35287174 GACACAAAATTTCAGTTAGGAGG + Intergenic
1188995296 X:36877540-36877562 GATACAAAGTTTCAGTTAGATGG + Intergenic
1188998291 X:36913496-36913518 GATACAAAATTTCAGTTACATGG + Intergenic
1189111996 X:38301018-38301040 GAGACAAGATTTCAGCAAAAAGG + Intronic
1189780850 X:44513116-44513138 AAGAAAAAATTTGAGATAATTGG + Intergenic
1190001922 X:46697200-46697222 GATACAAAGTTTCAGTTAGGAGG + Intronic
1190254306 X:48751112-48751134 GAGACAAAATTTCACTATGTTGG - Intergenic
1191655240 X:63589704-63589726 GATACAAAACTTCAGTTAGATGG - Intergenic
1192938436 X:75886196-75886218 TAGAAAAAATTTTAGTTAGTGGG + Intergenic
1193021001 X:76793288-76793310 GATAAAAAATTACAGTAAATAGG - Intergenic
1193531732 X:82662733-82662755 AAGAAAAAACTCCAGTTAATTGG + Intergenic
1194084899 X:89514745-89514767 GATACAAAATTTTAGTTAGCAGG - Intergenic
1194267157 X:91768442-91768464 GAAACAAAATTAAAGTGAATGGG - Intergenic
1194912385 X:99662699-99662721 AAGACAAATTTTTAGGTAATTGG + Intergenic
1195563094 X:106307568-106307590 GATAAAAAATTTCAGTTAAGAGG - Intergenic
1196011719 X:110895727-110895749 GACACAAAATTTCAGTTAGATGG + Intergenic
1196429659 X:115609462-115609484 GGGATAACATTTCACTTAATTGG + Intronic
1196472564 X:116045072-116045094 AATACAAAATTTCAGTTAGACGG + Intergenic
1196566920 X:117217980-117218002 GACACAAAATTTTAGTTAGGAGG + Intergenic
1197253266 X:124236694-124236716 GATACAAAAATTCAGTTAAATGG - Intronic
1197900869 X:131369803-131369825 GATACAAAATTCCAGTTAACAGG + Intronic
1197964782 X:132047997-132048019 GATACAAAATTTTAGTTAGGAGG + Intergenic
1198215778 X:134553314-134553336 GAGACAATTTTTGATTTAATGGG - Intergenic
1198419752 X:136459079-136459101 CAGACCAAATTTCATTCAATGGG - Intergenic
1198508202 X:137322491-137322513 GACATAAAATTTCAGTTAGGAGG + Intergenic
1198580376 X:138057630-138057652 GAAACAAAGTTTCAGTTACATGG + Intergenic
1198924760 X:141776920-141776942 GACATCAAATTTCAGTTAAGTGG - Intergenic
1199212536 X:145230558-145230580 AAGAAAAAAATTCAGATAATAGG + Intergenic
1199274474 X:145925443-145925465 GATACAAAATTTCAGTTGGGAGG + Intergenic
1199728617 X:150608749-150608771 GAGACAAAATTTCAGTTAATAGG - Intronic
1199922458 X:152422748-152422770 GATACAACATTTCAGTTCAACGG + Intronic
1200173318 X:154095247-154095269 CAGGCAAAATTTTAGTTAACAGG + Intronic
1200437549 Y:3170630-3170652 GATACAAAATTTTAGTTAGCAGG - Intergenic
1200584361 Y:4989381-4989403 GAAACAAAATTAAAGTGAATGGG - Intergenic
1200949809 Y:8885585-8885607 GAAATCAAATTTCAGTTAAGTGG - Intergenic