ID: 1199729645

View in Genome Browser
Species Human (GRCh38)
Location X:150619106-150619128
Sequence CACGAGATACGCGTTTCCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199729643_1199729645 7 Left 1199729643 X:150619076-150619098 CCACAGCAGAAGAGATATGTTTG 0: 1
1: 0
2: 1
3: 12
4: 206
Right 1199729645 X:150619106-150619128 CACGAGATACGCGTTTCCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199729645 Original CRISPR CACGAGATACGCGTTTCCCC TGG Exonic