ID: 1199729645 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:150619106-150619128 |
| Sequence | CACGAGATACGCGTTTCCCC TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 17 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 15} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199729643_1199729645 | 7 | Left | 1199729643 | X:150619076-150619098 | CCACAGCAGAAGAGATATGTTTG | 0: 1 1: 0 2: 1 3: 12 4: 206 |
||
| Right | 1199729645 | X:150619106-150619128 | CACGAGATACGCGTTTCCCCTGG | 0: 1 1: 0 2: 0 3: 1 4: 15 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199729645 | Original CRISPR | CACGAGATACGCGTTTCCCC TGG | Exonic | ||