ID: 1199730124

View in Genome Browser
Species Human (GRCh38)
Location X:150623503-150623525
Sequence AAGAGTGGCAGGCATGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199730119_1199730124 18 Left 1199730119 X:150623462-150623484 CCAGTTTGCAGGTGTTTAAAGGA 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1199730124 X:150623503-150623525 AAGAGTGGCAGGCATGTTGAGGG 0: 1
1: 0
2: 2
3: 26
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199730124 Original CRISPR AAGAGTGGCAGGCATGTTGA GGG Intronic
904397273 1:30230271-30230293 AACAGAGGCAGGGGTGTTGACGG + Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
911029395 1:93470033-93470055 AAGAGTGGCTGGCAAGTTCAGGG - Intronic
911987714 1:104651178-104651200 AAGAATGTCATGCATGCTGAAGG + Intergenic
913192228 1:116422729-116422751 TAGAGTGTCAGGCATCTTGGCGG - Intergenic
915738211 1:158098025-158098047 AACAGTAGCAAGCATGGTGAGGG + Intronic
915981879 1:160425451-160425473 AAGGGTGGCAGGAATGTGGCTGG - Exonic
915989241 1:160496578-160496600 AAGAGTGGCTGACATTTTGCTGG - Intronic
916415271 1:164586707-164586729 CAGATTGGCAGGCATGTGGAGGG + Intronic
920605891 1:207384526-207384548 AAAAGTGCCAGGCATGTTATTGG + Intergenic
921046961 1:211484741-211484763 AAGAGAGGGAGGCAGGCTGAGGG - Intronic
922725253 1:227920071-227920093 GAGAGGGGCGGGCATGGTGAGGG - Exonic
923976404 1:239269191-239269213 AAGACTGTTAGGAATGTTGATGG + Intergenic
924770339 1:247074456-247074478 AACAGTGGCAAGCATGTTAAAGG - Intronic
1064031449 10:11885682-11885704 AAGAGTGGCAGGCACTTTCTGGG + Intergenic
1066033817 10:31459019-31459041 AAGTGTTGCAGGCATATTTAAGG - Intronic
1066300354 10:34090511-34090533 AAGAGAGGCCAGCATGTAGAAGG - Intergenic
1067558524 10:47288539-47288561 AACGATGGCAGGCATGGTGAAGG - Intergenic
1070489570 10:76964085-76964107 AAGAGTGGAAGCCCTGTTGAAGG - Intronic
1071969889 10:90893409-90893431 AAGAATGGTAGGCATGTTCTAGG - Intronic
1072048628 10:91681783-91681805 AAGAGTGGCAGGGATTTTGCAGG + Intergenic
1072216129 10:93288724-93288746 AGGAGTGGCAGGGAACTTGAAGG - Intergenic
1073543874 10:104333368-104333390 AAGTGTGAGACGCATGTTGAAGG - Exonic
1073628335 10:105122017-105122039 AAGACTTGCTGGCATGTGGAAGG - Intronic
1074407306 10:113190565-113190587 CAGAGTGCCTGGCCTGTTGAAGG + Intergenic
1076201568 10:128563055-128563077 AAAAGTGGCAAGCATGGTGGTGG + Intergenic
1077999286 11:7480452-7480474 AAGAGAGGGAGTCAGGTTGATGG - Intergenic
1079944082 11:26719597-26719619 GAGTGTGACTGGCATGTTGAAGG - Intronic
1080272126 11:30461588-30461610 AAGACTGTCAGGCCTGTTGCAGG + Intronic
1080694830 11:34594268-34594290 AATAGTGTCTGGCATGTAGAAGG + Intergenic
1080762256 11:35263030-35263052 AATAGTGTCTGGCATGTTGTAGG - Intronic
1081195820 11:40159269-40159291 CAGAGCAGCAGGCATTTTGAAGG + Intronic
1081457051 11:43233880-43233902 AAGAGTCACAGGCACTTTGATGG + Intergenic
1081960550 11:47133472-47133494 AAGAGTGGCTGGCAGGTGGGTGG + Intronic
1082218656 11:49605368-49605390 AAGAGTGCCCGGAATTTTGAAGG - Intergenic
1083107439 11:60372340-60372362 AAGAATGGCAAGAATGTTGCAGG + Intronic
1084137173 11:67193517-67193539 AAGAGTCACAGCCATGTTGTTGG + Intronic
1085397043 11:76211668-76211690 AAGAATGTCAGGCATTTTGGGGG - Intergenic
1085876707 11:80416183-80416205 AAGAGTGGCATTAATGTTAAAGG + Intergenic
1086039906 11:82463580-82463602 AACAGTGTCTGGCATGTGGAAGG - Intergenic
1086606738 11:88704628-88704650 AAGAAAGGCAGGCATGGAGAGGG - Intronic
1088672585 11:112157655-112157677 AAGAGAAGCAGGCATTTTCAAGG + Intronic
1090044085 11:123315691-123315713 AACAGTGGCAGGCATGTGGCGGG + Intergenic
1091849294 12:3682306-3682328 TTGAGTGAAAGGCATGTTGAGGG - Intronic
1091864361 12:3818455-3818477 AAGAGTGGAAGGGCAGTTGATGG - Intronic
1093769036 12:22998428-22998450 GAGAGGGGCAGTCATGTAGAAGG + Intergenic
1095561375 12:43570022-43570044 AAAAATGTCAGGCATGTGGAGGG + Intergenic
1096320124 12:50604506-50604528 TACAGTGGCATGCATGTTCATGG + Intronic
1097655975 12:62363776-62363798 AATAGTGTCTGGCATGTAGAAGG + Intronic
1098444152 12:70549006-70549028 AATAGAGGCAGAAATGTTGAAGG - Intronic
1100364156 12:93904005-93904027 GAGAGTGCCTGGCATGCTGAGGG + Intergenic
1102145763 12:110654106-110654128 AAGTATGGCAGGTATGTTAATGG + Intronic
1106042736 13:26109134-26109156 AAAAGTGGCTGACATGTGGAAGG + Intergenic
1106697688 13:32194320-32194342 ATGAGTGGCAAGTATGTTTAGGG + Intronic
1107134489 13:36928999-36929021 AGAAGTGGCAGGCATGTTAAAGG + Intergenic
1108247146 13:48529325-48529347 AAGAGGGCCTGCCATGTTGAAGG - Intronic
1108683955 13:52803016-52803038 GAGAGTGTCAGGCATGTTCAAGG + Intergenic
1108948963 13:56063150-56063172 AAGAGTGGCTAGCAAGTAGAGGG + Intergenic
1110723284 13:78789836-78789858 AAGAGAGGCAGGATGGTTGAAGG - Intergenic
1111922185 13:94424008-94424030 AAAAGTTGCTGGCATGTAGAAGG - Intergenic
1112978920 13:105356954-105356976 TAGTGTGGAAGGCATGTTTACGG + Intergenic
1113484403 13:110643665-110643687 AAGAATGACAGGGATGTTCAGGG + Intronic
1116961628 14:50973366-50973388 TACTGTGGAAGGCATGTTGATGG + Intergenic
1128241806 15:66106454-66106476 AATGGTGCCAGGCATGTGGAGGG - Intronic
1128757072 15:70190374-70190396 AAGAGAGTCAGGGATGTTGGGGG + Intergenic
1128781402 15:70361205-70361227 ATGAGTGGAAGGCAGGTGGAAGG - Intergenic
1128798038 15:70479159-70479181 AAGAATGGCAGGCCCGCTGATGG + Intergenic
1130162083 15:81411641-81411663 AAGAGTGTGTGGCATGTAGAAGG + Intergenic
1130382257 15:83380572-83380594 AAGAGTGGGAGGAATGTTTGGGG + Intergenic
1132394573 15:101463384-101463406 AAGAGGGGAGGGAATGTTGATGG - Intronic
1132861961 16:2076247-2076269 CAGAGTGACAGGCAGGTGGAGGG + Intronic
1135961921 16:27002108-27002130 AAAAGTGTTTGGCATGTTGAAGG + Intergenic
1137681796 16:50353741-50353763 AAAATTGCCAGGCATGGTGATGG - Intronic
1139792078 16:69446474-69446496 AAAAGTGCCAGGCATGGTGGTGG - Intronic
1141363819 16:83423803-83423825 AAGATTGGCAGGAATGCTCAAGG - Intronic
1141383971 16:83602373-83602395 AAAGGTGGCAGGCGTGTTGCTGG - Intronic
1141551371 16:84808845-84808867 AGGAGAGGCAGGTGTGTTGAAGG - Intergenic
1142093037 16:88225382-88225404 TAGAGTGCGAGGCATTTTGAAGG + Intergenic
1143780992 17:9229706-9229728 CATAGTGGCAGGGATGTTGGTGG + Intronic
1146694247 17:34896780-34896802 GAAAGAGGCAGGCATGTTTAGGG - Intergenic
1146949397 17:36895150-36895172 AGGAGAGGCAGGCATGTATATGG - Intergenic
1147859179 17:43507131-43507153 AAGAGTGGCAGCTATGTCGGTGG + Exonic
1148223764 17:45883701-45883723 AAAAGTGGCTAGCATGTTAAAGG - Intergenic
1149768354 17:59299210-59299232 AAAATTAGCAGGCATGGTGACGG + Intergenic
1151055114 17:71021807-71021829 AAGAGAGGAAGGCATGAGGAGGG - Intergenic
1155511912 18:26586558-26586580 TAGTGAGGAAGGCATGTTGATGG + Intronic
1157318824 18:46618861-46618883 AATAGTGGCTGGCATGCTTAGGG + Intronic
1157713807 18:49868676-49868698 ATGAGTGGTAGGGATGGTGAGGG - Intronic
1158016798 18:52792653-52792675 AAGAATGGCAGGCATGCTAATGG + Intronic
1158020259 18:52833355-52833377 AAGTGTGGCAGAAATGTTTATGG - Intronic
1158536472 18:58312581-58312603 GGGAGGAGCAGGCATGTTGAAGG - Intronic
1159946086 18:74445790-74445812 AAGACTGGCAGGCATGTCATGGG - Intronic
1160022284 18:75190183-75190205 AGAAGGGGCAGGCATGGTGAGGG - Intergenic
1160371282 18:78373798-78373820 AAGAGCGGAAGGCAAGTTGTTGG + Intergenic
1160598172 18:79992150-79992172 TAGAATGGGAGGCAGGTTGAAGG + Intronic
1161598820 19:5167558-5167580 AAGAGTAGCAGGAATGAAGAGGG + Intronic
1165136298 19:33671850-33671872 AATAGTGCCAGGCATGTAGTAGG + Intronic
1165352233 19:35282101-35282123 AGGAGTGTCTGGCATGTTGGGGG - Intronic
1165991177 19:39815185-39815207 AAGAGTGCCTGGCATGAAGAAGG + Intergenic
1167002201 19:46752472-46752494 AACAGTGCCTGGCATGTTGTAGG + Intronic
1167069250 19:47210296-47210318 AATGGTGGCAGGAATGGTGAGGG - Intronic
925344830 2:3163810-3163832 AAGAGTGGCAGGGAGGTGGGAGG + Intergenic
925948871 2:8892815-8892837 AAGTGTGACTGGCATGTTGGAGG + Intronic
927494825 2:23545404-23545426 CAGAGTAGCAGGCATGCTGTCGG + Intronic
928816292 2:35298455-35298477 AAAACTGTCAGACATGTTGAGGG - Intergenic
929249078 2:39732895-39732917 AAGAAAGGCACGGATGTTGATGG - Intergenic
930200322 2:48546515-48546537 AAGATTGGCAGGAATGATGGTGG - Intronic
931244675 2:60482083-60482105 AAGAGAGGCAGACCTGTTAAGGG + Intronic
931646254 2:64424659-64424681 CAGAGGGGCAGGGATGGTGAAGG - Intergenic
932150723 2:69368878-69368900 AGTAATGGCAGGCGTGTTGATGG - Intronic
933873912 2:86599277-86599299 AAGTGTGACAGGCATGTACATGG + Intronic
933946459 2:87290103-87290125 AAGTCTGGCAGGCAGGATGAAGG + Intergenic
935411760 2:102771694-102771716 AAGTGTGGAAGGCATTTTCAGGG - Intronic
936105428 2:109620132-109620154 CACAGTGCCTGGCATGTTGAAGG + Intergenic
936333736 2:111571438-111571460 AAGTCTGGCAGGCAGGATGAAGG - Intergenic
937348663 2:121144523-121144545 ATGAGTGCCACACATGTTGAGGG + Intergenic
938200582 2:129369347-129369369 AAGTGTGACAGGGATGTTGAGGG - Intergenic
939462623 2:142516448-142516470 AAGTGTTCCAGGCATGTTTAAGG + Intergenic
940138556 2:150466564-150466586 AAAAGTGACAGGCATGTAGTAGG + Intergenic
942923474 2:181405335-181405357 GAGAATGGGAGGCCTGTTGAGGG - Intergenic
943868965 2:192967843-192967865 AAGAATGGTAAGCATGATGATGG + Intergenic
944845233 2:203661555-203661577 AGGAGAGGCTGGGATGTTGAGGG + Intergenic
946823924 2:223657130-223657152 AAGAGTGGCAGGCCAGATGAGGG - Intergenic
946927619 2:224641339-224641361 AACAATGGAAGGCCTGTTGATGG - Intergenic
947219449 2:227778650-227778672 AATGGTGGCAGACATGTTCAAGG - Intergenic
947237947 2:227963304-227963326 AAGATTGGCAGGCCTTTTGCAGG + Intergenic
947761885 2:232609498-232609520 AAGTGTGCCAGGCATGGTGTTGG + Intronic
948756771 2:240164682-240164704 AAGAGGGCCAGGCACGTTGTGGG - Intergenic
1169236204 20:3931876-3931898 CAGAGCCACAGGCATGTTGAGGG - Exonic
1171802341 20:29635428-29635450 AAGAGTGGCAGCAGAGTTGATGG - Intergenic
1172110632 20:32542774-32542796 AATAGTGCCTGGCATGTGGAAGG + Intronic
1172357103 20:34287889-34287911 AAGACTGTCAAGGATGTTGAGGG + Intronic
1173369709 20:42424447-42424469 GAGAGTGGGAGGCAGGTGGAAGG - Intronic
1174906179 20:54554122-54554144 AAAAGTTGCAGTGATGTTGATGG + Intronic
1175491008 20:59381283-59381305 AAGGGTAGCAGGCAGGTTGAAGG + Intergenic
1175570197 20:60012354-60012376 AGAAGTGGCAGCCATGCTGAGGG - Intronic
1176687912 21:9869534-9869556 CGGAGCAGCAGGCATGTTGATGG + Intergenic
1178736723 21:35159394-35159416 AAGAGAGACAGGCATGTAGAAGG + Intronic
1180072288 21:45442569-45442591 AAGAGTGGCAGTCCTGGTGTGGG + Intronic
1182806900 22:33080012-33080034 AGAGGTGGCAGGCATGTGGAGGG + Intergenic
1182997803 22:34830531-34830553 AAAAGTGGCATGTATGTTGGAGG - Intergenic
1183368044 22:37417551-37417573 CAGAGCGGCAGGCCTGTTGGGGG - Intronic
949263825 3:2134379-2134401 AAGAGAGGCAGACAGGTTGATGG + Intronic
949942664 3:9166761-9166783 AAGAGTGGAAGTCATGAGGAAGG - Intronic
950996335 3:17501484-17501506 AAGAGTAACAGGGATGGTGAGGG - Intronic
951162424 3:19441022-19441044 AAGACTGGCAGGCAGGAGGAGGG + Intronic
952276587 3:31883223-31883245 AAGAGTGGCATGCTTGTCAAAGG - Intronic
952671274 3:35972527-35972549 CAGAGAGGCAGGCAAGTTCATGG + Intergenic
953591972 3:44266420-44266442 TAGTGAGGAAGGCATGTTGACGG - Intronic
953879779 3:46685688-46685710 CAGAGTGGCAGGCAGCTTGCAGG - Intronic
954834362 3:53452777-53452799 AAGAGTGACAGGAATTTAGAGGG - Intergenic
955343532 3:58143897-58143919 AAAAATGGGAGGCATGGTGAGGG + Intronic
956014843 3:64871564-64871586 AACTGTGCCAGGCATGTTAAAGG + Intergenic
959473950 3:106786718-106786740 AAGATTGTCAGGTATTTTGAAGG - Intergenic
959612860 3:108314495-108314517 AAGATTGGCAGGGATGGGGAGGG + Intronic
960213803 3:115004939-115004961 AGAAATGGCTGGCATGTTGAAGG - Intronic
961115837 3:124329315-124329337 AACAGTGGGAGACCTGTTGAGGG + Intronic
963494225 3:146039985-146040007 GTGAATGGCAGGCATTTTGATGG + Intergenic
964998765 3:162924983-162925005 AAAATTGCCAGGCATGGTGATGG + Intergenic
965754377 3:172010463-172010485 AAGAGTGCCAGGCATGAAGTAGG + Intergenic
967939113 3:194753026-194753048 TTAAGGGGCAGGCATGTTGATGG - Intergenic
968514528 4:1010674-1010696 AAGACTGGGAGGCAGGATGAGGG + Intronic
970077853 4:12245102-12245124 AAGGGAGGCAGGCTTGTTGAGGG + Intergenic
970172744 4:13305701-13305723 GAGTGTGGCTGGCATGTTGGAGG - Intergenic
971091717 4:23353265-23353287 AAGAGTGGCAGAAAACTTGAAGG + Intergenic
971210045 4:24607606-24607628 AAGAGTAGCTGGGAGGTTGAAGG + Intergenic
971307838 4:25499181-25499203 AAGCATGGCAAGCATTTTGATGG + Intergenic
973139018 4:46743068-46743090 AACAGTGGCATACAGGTTGAAGG + Intronic
973897662 4:55431322-55431344 AAAAGTGGGAGGCATGTAGAGGG + Exonic
974369993 4:61003776-61003798 AACAGTGCCAGGAATGTTGTCGG + Intergenic
975395727 4:73870897-73870919 CACAGTGGCTGGCATGTTGCAGG - Exonic
976338527 4:83919007-83919029 AAGAGTATGAGGCATGTGGAAGG + Intergenic
980351271 4:131687367-131687389 TGGAGCAGCAGGCATGTTGATGG + Intergenic
980447811 4:132933991-132934013 TAGAGTGCAAGGCATGTGGAAGG + Intergenic
981172961 4:141646088-141646110 TAGAGTGTCATGCATGTTCATGG + Intronic
983918400 4:173316597-173316619 ATGTGTGCCAGGCATGTTGTAGG - Intronic
984517961 4:180765427-180765449 ATCAGTAGCAGGCATGTTTAAGG + Intergenic
988283043 5:29174371-29174393 AAGTGTGGCTGGCATGTTCCAGG + Intergenic
988792048 5:34617819-34617841 AAAATTGGCAGGCATGATGGTGG + Intergenic
989654090 5:43725749-43725771 AAGTGAGGAAGGCATCTTGAAGG - Intergenic
990102295 5:52206603-52206625 AGAAGTGGCAGGCATGGAGAGGG - Intergenic
990102349 5:52207295-52207317 AGAAGTGGCAGGCATGGAGAAGG + Intergenic
990739034 5:58893578-58893600 GAGACTGGAAGGGATGTTGAAGG + Intergenic
990780701 5:59358767-59358789 AAGAGTAGAAGGGATGTTGCTGG + Intronic
990964326 5:61428904-61428926 AAGAGTGACAGCCAAGGTGAGGG - Intronic
991123877 5:63047948-63047970 AAGAGATGCTGTCATGTTGAAGG + Intergenic
993710182 5:91216682-91216704 ATGAGTGGCTGCCATGTGGAGGG - Intergenic
994199664 5:96958492-96958514 ATGAATGTCAGGCATGTTGTGGG + Intronic
994368222 5:98940510-98940532 GAGAGTGGCAGGCAGGGGGAAGG - Intergenic
996397691 5:123029980-123030002 ATGAGTGGCAGGCCTTTTGAAGG - Intronic
998462501 5:142320185-142320207 AAGAGGGGGAGGGATGCTGAGGG + Intronic
998719006 5:144921491-144921513 AAGAGTGGCAGACACATTGTAGG - Intergenic
998764886 5:145475135-145475157 TAGAGTGGCTGGCATATTGCAGG + Intronic
999686483 5:154107843-154107865 CAGAGTTGCTGGCATGTTGATGG - Intronic
1000691222 5:164323762-164323784 AAGAGTGGCTCTCATATTGATGG + Intergenic
1001616945 5:173050136-173050158 AAGACTGGCTGTCATGCTGATGG + Intergenic
1002185148 5:177451000-177451022 CACAGTGGCAAGCATGGTGATGG + Intronic
1004325509 6:14670611-14670633 AAGCCTGCCAAGCATGTTGAAGG - Intergenic
1005038464 6:21579504-21579526 AAGAATGGCAGGGATGTGAATGG - Intergenic
1006080889 6:31565788-31565810 AATAGTGGCAGCCATGGAGATGG - Intergenic
1006950024 6:37814013-37814035 AAGATGGGCAGGCCTATTGAAGG + Intergenic
1007147133 6:39647375-39647397 AAGAGGGGCAGGCAGGTGTATGG + Intronic
1009684799 6:66943425-66943447 GAGAATTGCAGGAATGTTGAGGG + Intergenic
1010656690 6:78519755-78519777 AAGAGTAGAAAGCATCTTGAAGG + Intergenic
1011284202 6:85706327-85706349 CACAGTGGATGGCATGTTGATGG - Intergenic
1013355019 6:109339088-109339110 GAGGCTGGCAGGCATTTTGAGGG - Intergenic
1014449191 6:121564149-121564171 AACAGTGCCTGGCATGTTGAAGG - Intergenic
1014475697 6:121870218-121870240 TAGAGTGGCAGGCAGGAAGACGG - Intergenic
1015747008 6:136520875-136520897 AAGAGTGGCAGGAAAGAGGATGG + Intronic
1017527540 6:155254884-155254906 AACAGTGCCAGGCATCCTGAAGG + Intronic
1019566252 7:1680546-1680568 GAGAGTGGAAGGCACGGTGACGG - Intergenic
1019647209 7:2137452-2137474 CAGAGCGGCAGGCATGTTACCGG + Intronic
1020786423 7:12578960-12578982 GTGAGTGGCAGGAATGGTGAAGG - Intronic
1022315228 7:29239514-29239536 GAGAGTGGATGGCTTGTTGAGGG - Intronic
1023065119 7:36369136-36369158 AAGAGTGGCTGGCATGTAGTAGG + Intronic
1024935641 7:54709467-54709489 GAGAGTGGCAGGGATATCGAGGG - Intergenic
1026759443 7:73115426-73115448 GAGGGTGCCAGGCATGTTCATGG + Intergenic
1027087967 7:75278047-75278069 GAGGGTGCCAGGCATGTTCATGG - Intergenic
1029340555 7:99940469-99940491 AAGGGGGACAGCCATGTTGATGG - Intergenic
1029382232 7:100221657-100221679 CAGAGTGGCAGGGGTGTTGGGGG + Intronic
1029394078 7:100295180-100295202 GAGGGTGCCAGGCATGTTCATGG - Intergenic
1029663836 7:101981356-101981378 AAGAGTGGCTGGCATGTAGCAGG + Intronic
1030360107 7:108586748-108586770 GGAAGTGGCAGGCATGTTGATGG - Intergenic
1031390121 7:121203478-121203500 CAGAGTGGAAGCCATGCTGACGG - Intronic
1031840236 7:126728872-126728894 AAGAGTGTCTGACATGTTTAAGG - Intronic
1033010555 7:137617894-137617916 AAGAATGGCAGAAAAGTTGATGG + Intronic
1034279739 7:149844747-149844769 GACAGTGGCAGGGATGTGGATGG - Intronic
1035392515 7:158514675-158514697 AACAGCTGCATGCATGTTGATGG - Intronic
1035417887 7:158704901-158704923 AAGACTGGCGGGCATGTGGGCGG - Intergenic
1037164314 8:15808662-15808684 AAGAGTGCCAGACATGTAGCAGG + Intergenic
1037456088 8:19065679-19065701 AAGAGTGGCATGCCTGTGTAAGG - Intronic
1037511274 8:19585859-19585881 AAGAGGGGCAGCACTGTTGAAGG - Intronic
1044961822 8:97538729-97538751 AAGAGAAGCAGGCAAGTTCAGGG + Intergenic
1045946938 8:107806922-107806944 AATAGTGCCAGGCATGTGGTAGG + Intergenic
1046804070 8:118460952-118460974 AAAAGGGGCAGGCATTTTGGTGG - Intronic
1047260359 8:123253018-123253040 GAGACTGGCAGGCAGGTTGAGGG - Intronic
1047448485 8:124941119-124941141 AAGAATGAAAGGCATGCTGAAGG - Intergenic
1047861537 8:128972549-128972571 GAGAGTGGCAGGAAGGATGAAGG - Intergenic
1047887686 8:129270653-129270675 AAAAGTAGCAGGCAGGCTGATGG - Intergenic
1049151634 8:141038708-141038730 GAGAGTGGCAGGCCTCTTGGGGG + Intergenic
1050093847 9:2043350-2043372 AAGAGTGGCTGACATTTTGTAGG - Intronic
1051877374 9:21806517-21806539 CAGAGTGGGTGGCAGGTTGAGGG + Intronic
1052194569 9:25695823-25695845 GAAAGTGGAAGGCATGTTCATGG + Intergenic
1053781443 9:41612339-41612361 CGGAGCAGCAGGCATGTTGATGG - Intergenic
1054169390 9:61822491-61822513 CGGAGCAGCAGGCATGTTGATGG - Intergenic
1054668147 9:67758324-67758346 CGGAGCAGCAGGCATGTTGATGG + Intergenic
1055311945 9:74991856-74991878 AAGAATGGCAGGCATGTTACTGG - Intronic
1057439291 9:95071068-95071090 AACAGTGGCAGGCAGGGAGAAGG + Intronic
1057890271 9:98864664-98864686 AAGAGCTGCAGGGATGTTTAGGG + Intergenic
1058031487 9:100203020-100203042 ATGAGTGCAAGGCATGTTGGAGG + Intronic
1059130044 9:111737508-111737530 AATAGTGGCGGGCATGGTGGCGG + Intronic
1059735257 9:117094041-117094063 AAGAGTGGCAGGCATGTAGTTGG + Intronic
1060514469 9:124257459-124257481 AAGAGTCGCTGGCACTTTGAGGG + Intergenic
1061135583 9:128731537-128731559 CAGAGTGGCTGGCATGTGCAGGG + Intronic
1061956555 9:133965347-133965369 AAGTTAGGCAGGCATGATGATGG + Intronic
1062246176 9:135567570-135567592 AAGAGTCGCAGGCATGGGGAGGG + Intergenic
1187522256 X:20024187-20024209 TAGAGAGGAAAGCATGTTGAAGG - Intronic
1190106113 X:47562162-47562184 AGGAGTCGCAGGCACGGTGATGG - Intronic
1192221017 X:69197386-69197408 AAGATTGGCAAGCAGGTTGATGG + Intergenic
1198071193 X:133150197-133150219 AAGAGAGACTGGCATGTTCAAGG + Intergenic
1198164185 X:134037356-134037378 ATGAGAGGCAGGCATGTTGAAGG - Intergenic
1199221346 X:145319521-145319543 AAAAATGCCAGGCATGTTGGCGG - Intergenic
1199478550 X:148273287-148273309 CAGAGTGGCAGTCATTTTGCCGG - Intergenic
1199730124 X:150623503-150623525 AAGAGTGGCAGGCATGTTGAGGG + Intronic