ID: 1199731414

View in Genome Browser
Species Human (GRCh38)
Location X:150636716-150636738
Sequence ACTGTTAACATGGTTGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199731414 Original CRISPR ACTGTTAACATGGTTGTAGA TGG (reversed) Intronic
905486965 1:38306652-38306674 ACTGTAAACATTCTTGTACATGG + Intergenic
906174985 1:43763319-43763341 ACTTTTATCATTGTTGTAAATGG + Intronic
907601872 1:55780259-55780281 ACTGGCCACATGGTTGTAGCTGG + Intergenic
907619842 1:55965999-55966021 ACTGTTAACATTGTTTTTTATGG - Intergenic
909032608 1:70560260-70560282 ACTGGTCACATGGTTGTAGCTGG + Intergenic
909858643 1:80575008-80575030 ACTGGTCACATGGCTGTAGCTGG + Intergenic
910562172 1:88601993-88602015 GCTGGTCACATGGTTGTAGCTGG - Intergenic
912119854 1:106456949-106456971 AGTGCTACCAGGGTTGTAGAAGG - Intergenic
914735129 1:150409083-150409105 ACTGTTAACTTGGTAGGAGACGG - Intronic
916365835 1:164026847-164026869 ACTGGTCACATGGTTATAGCTGG + Intergenic
916489727 1:165291043-165291065 ACTGTTAAAATGGTTAAAAATGG + Intronic
917041358 1:170809469-170809491 ACTGCTAACATGGTGGTAGTGGG - Intergenic
917764810 1:178204043-178204065 ACTGGCCACATGGTTGTAGCTGG - Intronic
918916341 1:190644429-190644451 ACTATTAACATGATTATAAAAGG + Intergenic
921899674 1:220436935-220436957 CCAGGTAACATGGTTGTACAGGG + Intergenic
922018661 1:221680577-221680599 AATGTTTACATGGTTATACATGG + Intergenic
922092468 1:222410010-222410032 ACTGTTTTCATGGTTTCAGAGGG + Intergenic
924400631 1:243676740-243676762 ACTGTTAACATGAATGTTGGTGG - Intronic
1063334858 10:5202298-5202320 ACTCTCAACATGGTTGTTGTTGG + Intronic
1064418434 10:15169341-15169363 ATTGTTAACATGTATGTGGAGGG - Intergenic
1067666318 10:48282576-48282598 ACTGTTTACATGGTCGTTGCTGG + Intergenic
1069628695 10:69883806-69883828 GCAGTTTACAAGGTTGTAGAAGG + Intronic
1071476121 10:86026573-86026595 ATAGTTGACTTGGTTGTAGATGG - Intronic
1071937958 10:90551287-90551309 ACTGGTCACATGGTCGTAGCTGG - Intergenic
1072393921 10:95018754-95018776 AAAGATAAGATGGTTGTAGATGG + Intergenic
1075607084 10:123819442-123819464 GCTGGTCACATGGTCGTAGATGG - Intronic
1075750970 10:124770765-124770787 ACTGTGAACATTGTTGAAAAAGG - Intronic
1076006408 10:126951130-126951152 AGTGTTAGCATGGTTGTTGGTGG + Intronic
1080176383 11:29367821-29367843 ACTGTTAACATAATTCTAGGGGG + Intergenic
1081712573 11:45226801-45226823 ACTGTTGGCTTGGGTGTAGATGG + Intronic
1083093412 11:60223135-60223157 ACTGATCACATGGTTGTAGCTGG - Intronic
1084437622 11:69153511-69153533 ACTGTCAACAAGGCTGTAGGTGG + Intergenic
1086192932 11:84101852-84101874 ACTGTCAACATGTTTGGAGAGGG + Intronic
1086834391 11:91602397-91602419 ACTGATCACATGTTTGTAGCTGG - Intergenic
1086990036 11:93292689-93292711 ACTGGTCACATGGTTGTATCTGG - Intergenic
1088191395 11:107232669-107232691 ACTGGTCACATGGTCATAGATGG + Intergenic
1090196998 11:124825317-124825339 ACTGGTCACATGGTCGTAGCTGG + Intergenic
1090613560 11:128493728-128493750 ACTGTTCACTTAGTTATAGAAGG - Intronic
1091593554 12:1859699-1859721 CCTGTTAACAGAGTTGTAGGAGG + Intronic
1093000924 12:13994697-13994719 ACGATTAACATGATTGCAGAAGG + Intergenic
1093049393 12:14488977-14488999 ACTGGTCACATGGTAGTAGCTGG + Intronic
1094426913 12:30325557-30325579 ACTGTTCAAATGTGTGTAGAAGG - Intergenic
1096289049 12:50325258-50325280 GCTGGTCACATGGTTGTAGCTGG - Intergenic
1098750103 12:74281603-74281625 GCTGGTCACATGGTTGTAGCTGG - Intergenic
1099736100 12:86567728-86567750 ACTGGTCACGTGGTTGTAGCTGG - Intronic
1099994936 12:89768405-89768427 ACTGGTCACATGGTTCTAGCTGG + Intergenic
1101534334 12:105603749-105603771 GCTGATCACATGGTTGTAGCTGG + Intergenic
1104623616 12:130336733-130336755 ACTATAAACATGATTGTAGGAGG - Intergenic
1105590063 13:21784493-21784515 AGTTTTAATATGTTTGTAGATGG + Intergenic
1105996850 13:25680774-25680796 AATACAAACATGGTTGTAGAGGG - Intronic
1107182917 13:37482920-37482942 AATGTACACATGGTTGTACAAGG - Intergenic
1108779838 13:53816124-53816146 ACTGTTAACCTGATTGGTGAGGG + Intergenic
1108801466 13:54101343-54101365 ACTGTTCCAATGGTTGTGGAAGG - Intergenic
1109392579 13:61711328-61711350 ACTGGTCACATGGTTGTAGCTGG - Intergenic
1111057519 13:82971023-82971045 ACTGGTCACGTGGTTGTAGCTGG + Intergenic
1111536037 13:89604604-89604626 ACTGGTCACATGGTCGTAGCTGG + Intergenic
1112723222 13:102271008-102271030 GCAGTTAACATGGTTTTAAAAGG + Intronic
1113600166 13:111562989-111563011 ACTGTTCACATGCTGGTGGATGG + Intergenic
1120460686 14:84791320-84791342 ACTGGTTAAATGGTTGTAAATGG + Intergenic
1120713096 14:87813524-87813546 ACTGTTAACATGAGTGAAGGTGG - Intergenic
1121557388 14:94848744-94848766 TCTGTTACCCTGTTTGTAGATGG - Intergenic
1121935320 14:98013187-98013209 AGGGTTAACATAGTTGGAGAAGG - Intergenic
1123128395 14:105966214-105966236 ACTGATCACGTGGTTGTAGCTGG - Intergenic
1124368095 15:29088169-29088191 CCTGCTAGCATGGGTGTAGATGG + Intronic
1125119990 15:36144800-36144822 AATATTAACATGGTTAAAGAAGG - Intergenic
1125852911 15:42921184-42921206 ACAGTTAAATTGGTTATAGAGGG + Intergenic
1126187330 15:45842882-45842904 ACTGATAACATGGTTGCATCAGG - Intergenic
1126282244 15:46967251-46967273 CCTGTTAACATGGATGGAAATGG + Intergenic
1127933472 15:63613488-63613510 ACTTTTTAAATGGTGGTAGATGG - Intronic
1129686703 15:77690173-77690195 CCTGGTAACATGGTTGGGGAAGG + Intronic
1131821550 15:96279127-96279149 ACTGTTACCATGGTGGAATAGGG + Intergenic
1131895640 15:97026554-97026576 ACTGGTCACATGATTGTAGTTGG + Intergenic
1132217887 15:100080633-100080655 GCTGGTCACATGGTTGTAGCTGG - Intronic
1144278565 17:13700842-13700864 AATGTTAACATTATTGAAGATGG + Intergenic
1146808230 17:35882398-35882420 ACTTGTAACATGGTGGTTGACGG + Intergenic
1149757232 17:59197628-59197650 ACTTTTAAAATGGACGTAGAAGG - Intronic
1155338975 18:24795015-24795037 ACTGTTAACATGCTTATAAGGGG + Intergenic
1159711611 18:71766457-71766479 ACTGGGCACATGGTTGTAGCTGG - Intronic
1160092720 18:75842022-75842044 ACTGATCACATGGTTGTAGCTGG - Intergenic
1161514302 19:4688276-4688298 ATTTTTAACATTTTTGTAGAGGG + Intronic
1163310743 19:16513071-16513093 ACTGATAACATGATTGGCGATGG - Exonic
1165615650 19:37197866-37197888 AATGTTAACAGGGATGTAGAAGG + Intronic
1167152019 19:47715724-47715746 AATGGTGACATGGTTGAAGAAGG - Intronic
928845941 2:35672314-35672336 ACTGTTAAAATGGGTATAAAAGG - Intergenic
930480897 2:51947259-51947281 ACTGGTCACATGGTTGTAGCTGG + Intergenic
932698424 2:73976463-73976485 AATTTTAACATGGTTTGAGATGG + Intergenic
935527153 2:104184015-104184037 ACTGGTCACATGGTTGTAGCTGG - Intergenic
939249170 2:139663641-139663663 GCAGTTTACATGGTTGAAGAAGG + Intergenic
941583936 2:167333107-167333129 TCTGTTAAAATGGTAGTAAAAGG + Intergenic
942518872 2:176782150-176782172 AATGTTAAAATCTTTGTAGAAGG - Intergenic
943021111 2:182575031-182575053 GCTGGTCACATGGTTGTAGCTGG + Intergenic
943182553 2:184561648-184561670 ACTGGTAACATGGGTGTAGCTGG - Intergenic
943383799 2:187179085-187179107 GCTGGTCACATGGTTGTAGCTGG + Intergenic
944913888 2:204337764-204337786 ATTCTCAACATGGATGTAGAAGG - Intergenic
945107973 2:206334616-206334638 AGTGTTAACATGGTGGGAGGCGG + Intergenic
946621541 2:221569285-221569307 ACTATTTACTTGGTTGTGGAAGG - Intronic
1169731663 20:8792783-8792805 ACTGTTAACATTGTAGGACATGG + Intronic
1178326303 21:31647955-31647977 ACTTTTCACATGGCTGTAGCTGG - Intergenic
1181838997 22:25638434-25638456 ACTGGTCACATGGTTGTAGCTGG + Intronic
949615001 3:5743847-5743869 ACTGGTCACATGGTTGTAGCTGG - Intergenic
950678545 3:14569262-14569284 ATGATTAACATGGTTGCAGAAGG + Intergenic
952077679 3:29717603-29717625 TCTGTTAACGTTTTTGTAGAAGG + Intronic
955157766 3:56434126-56434148 CCTTTTCACATGGTTGCAGATGG - Intronic
955559157 3:60170045-60170067 ACAGTTCACATGATTGGAGAAGG + Intronic
957253834 3:77811277-77811299 ACTGTTAACATGGAGGAGGAAGG + Intergenic
958991422 3:100850179-100850201 AATTTTAACATGCTTTTAGATGG + Intronic
959200361 3:103238210-103238232 ACTATTAACATGGCTTTATAAGG + Intergenic
959753003 3:109860339-109860361 ACTGTTAGCTTAGATGTAGAGGG - Intergenic
962446824 3:135473373-135473395 TCTGTGAAGATGGTTGTAAATGG + Intergenic
963828145 3:149977915-149977937 ACTTTTAAAATGCTTGTAAATGG - Intronic
965708225 3:171531144-171531166 ACTGGTCATATGGTTGTAGCTGG + Intergenic
966272185 3:178120749-178120771 ACAGTTCACATGGTTGGAGCAGG - Intergenic
970505444 4:16724616-16724638 TCTGTGAACATGGTTCTGGAAGG - Intronic
970927046 4:21464908-21464930 ACTTTTTCCATGGTCGTAGAGGG - Intronic
972067223 4:34963370-34963392 ATTGTTAACATAGTTGTATGAGG + Intergenic
972095760 4:35344810-35344832 ACTGGTCACATGATTGTAGCTGG - Intergenic
973092855 4:46159092-46159114 ACTGGTCACTTGGTTGTAGCTGG - Intergenic
974565045 4:63570314-63570336 ACTGGTCACATGGTCGTAGCTGG - Intergenic
974663614 4:64928188-64928210 ACAGTCAACATAGTTGTAGAGGG + Intergenic
974664563 4:64941126-64941148 ACTGTTAACATTCTTGTCAATGG - Intergenic
979371812 4:119897391-119897413 ACAGTTACCAGGGTTGCAGATGG + Intergenic
980958067 4:139448315-139448337 ACTGTTCACTTGGTTGTAGCTGG - Intergenic
981538429 4:145824218-145824240 ACTGTGGTCATGGTTTTAGAGGG - Intronic
984301353 4:177922908-177922930 ACTGGTCACATTGTTGTAGTTGG + Intronic
985074433 4:186199135-186199157 ACAGTTAAAATGGTTATAAAGGG - Intronic
985403142 4:189611859-189611881 ACTGTTAACATTTATGTTGATGG + Intergenic
985939539 5:3123979-3124001 ACTGTAAACAAGGTTGCAGGGGG - Intergenic
986743220 5:10721753-10721775 ACTGGTCACATGGTCGTAGCTGG - Intronic
987322601 5:16784464-16784486 ACAGTTAACAAGGCTGGAGACGG + Intronic
988160551 5:27514865-27514887 GCTGATCACATGGTTGTAGCTGG + Intergenic
989001523 5:36765685-36765707 ACTGCTAACATTTTTGTACATGG + Intergenic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
990988062 5:61659355-61659377 ACTGTTACTATGGTTGCTGAGGG + Intronic
991024760 5:62017760-62017782 ACTGTTTTCATGATTGAAGAGGG + Intergenic
993571231 5:89541402-89541424 ACTGATAACATTGGTTTAGAGGG - Intergenic
993780933 5:92064388-92064410 ACTGGTTACATGGTTGTAGCTGG - Intergenic
994592058 5:101785535-101785557 ACTGTAGAAATGTTTGTAGATGG + Intergenic
994703600 5:103170114-103170136 AGTGTTAACAGTATTGTAGATGG + Intronic
994944283 5:106365533-106365555 AATTTTAACATTTTTGTAGAAGG - Intergenic
998869230 5:146536015-146536037 TTTGTTAACATGTTTGTTGAAGG + Intergenic
999351649 5:150876820-150876842 ACTGGTCACATGGTCGTAGCTGG - Intronic
999746481 5:154596075-154596097 ACTTTAAACAGGGATGTAGAGGG - Intergenic
1000488554 5:161879859-161879881 GCTGCTAATATAGTTGTAGAGGG - Intronic
1000771731 5:165363013-165363035 ACTCTTAAAATGGTTGTGCATGG - Intergenic
1001173794 5:169445941-169445963 ACTGGTCACGTGGTTGTAGCTGG - Intergenic
1003090996 6:3102913-3102935 ACTGTTAAAATTGTTTTACATGG + Intronic
1008079109 6:47176569-47176591 ACTGGTCACATGGTTGTAGCTGG + Intergenic
1009438615 6:63648390-63648412 AATATTAACATGGTTGTTGCTGG + Intronic
1010325889 6:74561394-74561416 ACTGCTCACGTGGTTGTAGCTGG - Intergenic
1012002199 6:93666911-93666933 ACTGGTCACATGGTTGTAGCTGG - Intergenic
1012920507 6:105217553-105217575 GCTGGTCACATGGTTGTAGCTGG + Intergenic
1013645185 6:112131046-112131068 ACTGTCATCATGGATGTAAAGGG - Exonic
1014173478 6:118305824-118305846 ACTGGTCACATGGTTGCAGCTGG + Intronic
1014387263 6:120817905-120817927 TCTGTTAACAATGCTGTAGAAGG + Intergenic
1015160907 6:130151346-130151368 ACTGTTAACATGGATAAAGCTGG - Intronic
1017932697 6:158973031-158973053 ACTGTGAACAAGATTGTGGAAGG + Intronic
1018425528 6:163676878-163676900 ACTGGTCACATGATTGTAGCTGG - Intergenic
1023566308 7:41526862-41526884 AGTGTTAACATGCCTGTTGAAGG + Intergenic
1027656465 7:80936253-80936275 GCTTTTAACATGTTTCTAGAAGG - Intergenic
1029853657 7:103490718-103490740 GCTGTTGACAGAGTTGTAGATGG + Exonic
1030506961 7:110436682-110436704 ACTGGTCACGTGGTTGTAGCTGG - Intergenic
1031526977 7:122834154-122834176 ACAGCTAACATGATGGTAGAAGG + Intronic
1031833286 7:126652017-126652039 ACTGGTCACATGGTCGTAGCTGG - Intronic
1031979360 7:128114758-128114780 GCTCTTGACATGGTGGTAGAGGG + Intergenic
1039124400 8:34184966-34184988 ACATTTAAAATGGTGGTAGAAGG + Intergenic
1039356921 8:36828695-36828717 GTTGTTAACATGCTTGTATATGG + Intronic
1040010259 8:42655707-42655729 ACTGTTAACTAGACTGTAGATGG + Intergenic
1040912204 8:52530417-52530439 GCTGGTCACATGGTTGTAGCTGG - Intergenic
1041274189 8:56141241-56141263 ACTGATCACATGATTGTAGCTGG + Intergenic
1041391420 8:57350383-57350405 ACTCTGAACATGGTTGGAGTAGG - Intergenic
1042687321 8:71456605-71456627 AAAGATCACATGGTTGTAGATGG - Intronic
1043190801 8:77220505-77220527 TCTGGTAACGTGGTTGTAGCTGG - Intergenic
1043760290 8:84060256-84060278 ATTATTAACATGATTGTAAATGG - Intergenic
1044483264 8:92718177-92718199 ACTTTTAACATGCTTTTACATGG + Intergenic
1045950427 8:107845529-107845551 CTTTTTAAGATGGTTGTAGATGG + Intergenic
1046404033 8:113748987-113749009 ACTGTTAAGTTGATTATAGAAGG - Intergenic
1046500496 8:115070210-115070232 ACTGGTGACATGGTTGCAGGTGG - Intergenic
1047625237 8:126649454-126649476 ACTGGTAAGATGGTTTGAGATGG + Intergenic
1048943387 8:139422589-139422611 ACTGTTCACATGGTTGTTGCAGG - Intergenic
1049314493 8:141955189-141955211 ACTGTTAATTTTGTTCTAGATGG - Intergenic
1049946513 9:601974-601996 CCTGTGAACATGGTTGTACCAGG + Intronic
1051440813 9:17080745-17080767 TCTATTAACATGGTTTTAGATGG - Intergenic
1051882227 9:21851274-21851296 GCTGGTCACATGGTTGTAGCTGG - Intronic
1052024263 9:23557275-23557297 ACTGTGAACATTGGTGTACAAGG - Intergenic
1060991344 9:127851075-127851097 ACCGTTAGTATGGTGGTAGATGG - Intronic
1061370898 9:130196853-130196875 ACTGTTATCATGGCTGTCGCTGG - Intronic
1186469476 X:9810128-9810150 GCTGGTCACATGGTTGTAGCTGG + Intronic
1186567024 X:10673866-10673888 AATGATAACATGCTTGTAAAGGG + Intronic
1186738290 X:12489911-12489933 ACTTATAACATTGTTGAAGAAGG - Intronic
1188580118 X:31701584-31701606 AAAATAAACATGGTTGTAGACGG - Intronic
1191759592 X:64631712-64631734 GCTGGTGACATGGTTGTAGCTGG - Intergenic
1192898941 X:75473701-75473723 ACTGGTCACATGGTTGTAGCTGG - Intronic
1193119120 X:77805268-77805290 TGTGTTCACATGGATGTAGAAGG - Intergenic
1193376269 X:80765537-80765559 ACTGGTCACATGGTTGTAGTTGG - Intronic
1195933056 X:110098361-110098383 GCTGTAAACATTGGTGTAGAGGG + Intronic
1196101905 X:111855447-111855469 TCTGCTAACATGGTTATTGAGGG - Intronic
1197578626 X:128254970-128254992 TTTGTTAGCATGGTGGTAGATGG - Intergenic
1197988752 X:132294870-132294892 ACTGGTCACATGGTTGTAGTTGG + Intergenic
1198201113 X:134419848-134419870 ACTTTTAACATTCTTCTAGAGGG + Intronic
1199007709 X:142721822-142721844 AATGATCACATGGTTATAGATGG - Intergenic
1199731414 X:150636716-150636738 ACTGTTAACATGGTTGTAGATGG - Intronic
1200745703 Y:6902317-6902339 GCTGGTCACATGGTTGTAGCTGG + Intergenic