ID: 1199734863

View in Genome Browser
Species Human (GRCh38)
Location X:150676377-150676399
Sequence GCACCCTGCTTGGAAATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199734863_1199734869 13 Left 1199734863 X:150676377-150676399 CCAGTAATTTCCAAGCAGGGTGC No data
Right 1199734869 X:150676413-150676435 AGAGACAGATGGTGGACTTCTGG No data
1199734863_1199734868 5 Left 1199734863 X:150676377-150676399 CCAGTAATTTCCAAGCAGGGTGC No data
Right 1199734868 X:150676405-150676427 GCAAGGATAGAGACAGATGGTGG No data
1199734863_1199734870 14 Left 1199734863 X:150676377-150676399 CCAGTAATTTCCAAGCAGGGTGC No data
Right 1199734870 X:150676414-150676436 GAGACAGATGGTGGACTTCTGGG No data
1199734863_1199734871 24 Left 1199734863 X:150676377-150676399 CCAGTAATTTCCAAGCAGGGTGC No data
Right 1199734871 X:150676424-150676446 GTGGACTTCTGGGCCAGTATAGG No data
1199734863_1199734867 2 Left 1199734863 X:150676377-150676399 CCAGTAATTTCCAAGCAGGGTGC No data
Right 1199734867 X:150676402-150676424 CCTGCAAGGATAGAGACAGATGG No data
1199734863_1199734872 25 Left 1199734863 X:150676377-150676399 CCAGTAATTTCCAAGCAGGGTGC No data
Right 1199734872 X:150676425-150676447 TGGACTTCTGGGCCAGTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199734863 Original CRISPR GCACCCTGCTTGGAAATTAC TGG (reversed) Intergenic
No off target data available for this crispr