ID: 1199734869

View in Genome Browser
Species Human (GRCh38)
Location X:150676413-150676435
Sequence AGAGACAGATGGTGGACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199734863_1199734869 13 Left 1199734863 X:150676377-150676399 CCAGTAATTTCCAAGCAGGGTGC No data
Right 1199734869 X:150676413-150676435 AGAGACAGATGGTGGACTTCTGG No data
1199734860_1199734869 21 Left 1199734860 X:150676369-150676391 CCAGTTAACCAGTAATTTCCAAG No data
Right 1199734869 X:150676413-150676435 AGAGACAGATGGTGGACTTCTGG No data
1199734864_1199734869 3 Left 1199734864 X:150676387-150676409 CCAAGCAGGGTGCTGCCTGCAAG No data
Right 1199734869 X:150676413-150676435 AGAGACAGATGGTGGACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199734869 Original CRISPR AGAGACAGATGGTGGACTTC TGG Intergenic
No off target data available for this crispr