ID: 1199734872

View in Genome Browser
Species Human (GRCh38)
Location X:150676425-150676447
Sequence TGGACTTCTGGGCCAGTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199734863_1199734872 25 Left 1199734863 X:150676377-150676399 CCAGTAATTTCCAAGCAGGGTGC No data
Right 1199734872 X:150676425-150676447 TGGACTTCTGGGCCAGTATAGGG No data
1199734864_1199734872 15 Left 1199734864 X:150676387-150676409 CCAAGCAGGGTGCTGCCTGCAAG No data
Right 1199734872 X:150676425-150676447 TGGACTTCTGGGCCAGTATAGGG No data
1199734866_1199734872 0 Left 1199734866 X:150676402-150676424 CCTGCAAGGATAGAGACAGATGG No data
Right 1199734872 X:150676425-150676447 TGGACTTCTGGGCCAGTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199734872 Original CRISPR TGGACTTCTGGGCCAGTATA GGG Intergenic
No off target data available for this crispr