ID: 1199735760

View in Genome Browser
Species Human (GRCh38)
Location X:150685423-150685445
Sequence AGATGTCAGCTGGAGTTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199735760_1199735768 -2 Left 1199735760 X:150685423-150685445 CCCCCTAACTCCAGCTGACATCT No data
Right 1199735768 X:150685444-150685466 CTACTTGGCAAGCAGGGCAATGG No data
1199735760_1199735770 14 Left 1199735760 X:150685423-150685445 CCCCCTAACTCCAGCTGACATCT No data
Right 1199735770 X:150685460-150685482 GCAATGGAAGGCTTCAACATTGG No data
1199735760_1199735766 -9 Left 1199735760 X:150685423-150685445 CCCCCTAACTCCAGCTGACATCT No data
Right 1199735766 X:150685437-150685459 CTGACATCTACTTGGCAAGCAGG No data
1199735760_1199735769 2 Left 1199735760 X:150685423-150685445 CCCCCTAACTCCAGCTGACATCT No data
Right 1199735769 X:150685448-150685470 TTGGCAAGCAGGGCAATGGAAGG No data
1199735760_1199735767 -8 Left 1199735760 X:150685423-150685445 CCCCCTAACTCCAGCTGACATCT No data
Right 1199735767 X:150685438-150685460 TGACATCTACTTGGCAAGCAGGG No data
1199735760_1199735771 27 Left 1199735760 X:150685423-150685445 CCCCCTAACTCCAGCTGACATCT No data
Right 1199735771 X:150685473-150685495 TCAACATTGGTTCTCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199735760 Original CRISPR AGATGTCAGCTGGAGTTAGG GGG (reversed) Intergenic
No off target data available for this crispr