ID: 1199735766

View in Genome Browser
Species Human (GRCh38)
Location X:150685437-150685459
Sequence CTGACATCTACTTGGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199735757_1199735766 22 Left 1199735757 X:150685392-150685414 CCCATGTGGTGGTGCTCAGGATG No data
Right 1199735766 X:150685437-150685459 CTGACATCTACTTGGCAAGCAGG No data
1199735758_1199735766 21 Left 1199735758 X:150685393-150685415 CCATGTGGTGGTGCTCAGGATGA No data
Right 1199735766 X:150685437-150685459 CTGACATCTACTTGGCAAGCAGG No data
1199735760_1199735766 -9 Left 1199735760 X:150685423-150685445 CCCCCTAACTCCAGCTGACATCT No data
Right 1199735766 X:150685437-150685459 CTGACATCTACTTGGCAAGCAGG No data
1199735761_1199735766 -10 Left 1199735761 X:150685424-150685446 CCCCTAACTCCAGCTGACATCTA No data
Right 1199735766 X:150685437-150685459 CTGACATCTACTTGGCAAGCAGG No data
1199735756_1199735766 23 Left 1199735756 X:150685391-150685413 CCCCATGTGGTGGTGCTCAGGAT No data
Right 1199735766 X:150685437-150685459 CTGACATCTACTTGGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199735766 Original CRISPR CTGACATCTACTTGGCAAGC AGG Intergenic
No off target data available for this crispr