ID: 1199735767

View in Genome Browser
Species Human (GRCh38)
Location X:150685438-150685460
Sequence TGACATCTACTTGGCAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199735760_1199735767 -8 Left 1199735760 X:150685423-150685445 CCCCCTAACTCCAGCTGACATCT No data
Right 1199735767 X:150685438-150685460 TGACATCTACTTGGCAAGCAGGG No data
1199735757_1199735767 23 Left 1199735757 X:150685392-150685414 CCCATGTGGTGGTGCTCAGGATG No data
Right 1199735767 X:150685438-150685460 TGACATCTACTTGGCAAGCAGGG No data
1199735761_1199735767 -9 Left 1199735761 X:150685424-150685446 CCCCTAACTCCAGCTGACATCTA No data
Right 1199735767 X:150685438-150685460 TGACATCTACTTGGCAAGCAGGG No data
1199735756_1199735767 24 Left 1199735756 X:150685391-150685413 CCCCATGTGGTGGTGCTCAGGAT No data
Right 1199735767 X:150685438-150685460 TGACATCTACTTGGCAAGCAGGG No data
1199735758_1199735767 22 Left 1199735758 X:150685393-150685415 CCATGTGGTGGTGCTCAGGATGA No data
Right 1199735767 X:150685438-150685460 TGACATCTACTTGGCAAGCAGGG No data
1199735762_1199735767 -10 Left 1199735762 X:150685425-150685447 CCCTAACTCCAGCTGACATCTAC No data
Right 1199735767 X:150685438-150685460 TGACATCTACTTGGCAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199735767 Original CRISPR TGACATCTACTTGGCAAGCA GGG Intergenic
No off target data available for this crispr