ID: 1199735768

View in Genome Browser
Species Human (GRCh38)
Location X:150685444-150685466
Sequence CTACTTGGCAAGCAGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199735762_1199735768 -4 Left 1199735762 X:150685425-150685447 CCCTAACTCCAGCTGACATCTAC No data
Right 1199735768 X:150685444-150685466 CTACTTGGCAAGCAGGGCAATGG No data
1199735763_1199735768 -5 Left 1199735763 X:150685426-150685448 CCTAACTCCAGCTGACATCTACT No data
Right 1199735768 X:150685444-150685466 CTACTTGGCAAGCAGGGCAATGG No data
1199735756_1199735768 30 Left 1199735756 X:150685391-150685413 CCCCATGTGGTGGTGCTCAGGAT No data
Right 1199735768 X:150685444-150685466 CTACTTGGCAAGCAGGGCAATGG No data
1199735757_1199735768 29 Left 1199735757 X:150685392-150685414 CCCATGTGGTGGTGCTCAGGATG No data
Right 1199735768 X:150685444-150685466 CTACTTGGCAAGCAGGGCAATGG No data
1199735760_1199735768 -2 Left 1199735760 X:150685423-150685445 CCCCCTAACTCCAGCTGACATCT No data
Right 1199735768 X:150685444-150685466 CTACTTGGCAAGCAGGGCAATGG No data
1199735761_1199735768 -3 Left 1199735761 X:150685424-150685446 CCCCTAACTCCAGCTGACATCTA No data
Right 1199735768 X:150685444-150685466 CTACTTGGCAAGCAGGGCAATGG No data
1199735758_1199735768 28 Left 1199735758 X:150685393-150685415 CCATGTGGTGGTGCTCAGGATGA No data
Right 1199735768 X:150685444-150685466 CTACTTGGCAAGCAGGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199735768 Original CRISPR CTACTTGGCAAGCAGGGCAA TGG Intergenic
No off target data available for this crispr