ID: 1199735770

View in Genome Browser
Species Human (GRCh38)
Location X:150685460-150685482
Sequence GCAATGGAAGGCTTCAACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199735763_1199735770 11 Left 1199735763 X:150685426-150685448 CCTAACTCCAGCTGACATCTACT No data
Right 1199735770 X:150685460-150685482 GCAATGGAAGGCTTCAACATTGG No data
1199735762_1199735770 12 Left 1199735762 X:150685425-150685447 CCCTAACTCCAGCTGACATCTAC No data
Right 1199735770 X:150685460-150685482 GCAATGGAAGGCTTCAACATTGG No data
1199735765_1199735770 4 Left 1199735765 X:150685433-150685455 CCAGCTGACATCTACTTGGCAAG No data
Right 1199735770 X:150685460-150685482 GCAATGGAAGGCTTCAACATTGG No data
1199735761_1199735770 13 Left 1199735761 X:150685424-150685446 CCCCTAACTCCAGCTGACATCTA No data
Right 1199735770 X:150685460-150685482 GCAATGGAAGGCTTCAACATTGG No data
1199735760_1199735770 14 Left 1199735760 X:150685423-150685445 CCCCCTAACTCCAGCTGACATCT No data
Right 1199735770 X:150685460-150685482 GCAATGGAAGGCTTCAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199735770 Original CRISPR GCAATGGAAGGCTTCAACAT TGG Intergenic
No off target data available for this crispr