ID: 1199737469

View in Genome Browser
Species Human (GRCh38)
Location X:150696984-150697006
Sequence CTTTATCAGAAGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 287}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199737463_1199737469 -3 Left 1199737463 X:150696964-150696986 CCCAAAGTAAAGAGGAAGGTCTT 0: 1
1: 0
2: 0
3: 25
4: 233
Right 1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG 0: 1
1: 0
2: 2
3: 32
4: 287
1199737460_1199737469 21 Left 1199737460 X:150696940-150696962 CCTGTGTTGTGGGGAAGGGCAGT 0: 1
1: 0
2: 2
3: 27
4: 210
Right 1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG 0: 1
1: 0
2: 2
3: 32
4: 287
1199737464_1199737469 -4 Left 1199737464 X:150696965-150696987 CCAAAGTAAAGAGGAAGGTCTTT 0: 1
1: 0
2: 0
3: 20
4: 225
Right 1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG 0: 1
1: 0
2: 2
3: 32
4: 287
1199737456_1199737469 30 Left 1199737456 X:150696931-150696953 CCACAGAAGCCTGTGTTGTGGGG 0: 1
1: 0
2: 0
3: 25
4: 264
Right 1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG 0: 1
1: 0
2: 2
3: 32
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199737469 Original CRISPR CTTTATCAGAAGAAGGGGGA AGG Intronic
900543982 1:3218335-3218357 CTTTATCGGAGAAGGGGGGAGGG + Intronic
901907028 1:12421825-12421847 CTGTCTCAAAAAAAGGGGGATGG - Intronic
903588685 1:24437875-24437897 GTTTATCAGAAGAAAAGGAAAGG + Intronic
903690918 1:25172990-25173012 ATTTATAAGAAGAAAGGTGAAGG + Intergenic
906533009 1:46534133-46534155 CTTCATCTGAATAAGGGGGTGGG - Intergenic
907182921 1:52586588-52586610 CTCAATCAGAAGGTGGGGGAAGG + Intergenic
910997511 1:93123763-93123785 CTTTATTAAAAAAAGGGGGGGGG - Intronic
911133609 1:94416735-94416757 ATTTTACAGAAAAAGGGGGAGGG - Intergenic
912368812 1:109156947-109156969 TTCTCTCAGAAGAAGGGGGGTGG + Intronic
913251529 1:116915759-116915781 CTTTATCAAATGAAGTTGGAAGG + Intronic
914918906 1:151834446-151834468 CTTTGTGACAAGAAGGGGGAGGG - Intergenic
918768967 1:188528570-188528592 CTTTATAAGAGGAAGGCCGAGGG - Intergenic
919516525 1:198532276-198532298 CTTTAAGAAAAGAAGGAGGAAGG + Intronic
920203019 1:204272039-204272061 CTTAATCCGGGGAAGGGGGAGGG - Intronic
921248208 1:213269699-213269721 CTATATCAGAAAAAAAGGGAAGG + Intronic
921546206 1:216478009-216478031 CTTTATAAGAAGGAGGCAGAGGG + Intergenic
921637286 1:217511651-217511673 CTTTAACAGAAGAAGGTATATGG - Intronic
922773929 1:228206533-228206555 CTCAATCAGAAGGAGGGTGAGGG - Intronic
924700524 1:246447230-246447252 CTTTATCAGAGGAATTGGGGAGG + Intronic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1062802521 10:390678-390700 CTTTGTCAGAAGACGGGTGCGGG - Intronic
1062908445 10:1195683-1195705 CTGGTTCAGAAGAAGAGGGATGG + Intronic
1063585820 10:7351333-7351355 CTTAACCAGAAGAATGAGGATGG + Intronic
1064884315 10:20092775-20092797 CTTTATAAGAGGAAGGGAAAGGG + Intronic
1066320890 10:34302796-34302818 ATTTTTCAGAAGAAGGCAGATGG + Intronic
1072463988 10:95646335-95646357 CTGTATCAGGAGAAGAGGGTGGG + Intronic
1072686443 10:97540040-97540062 CCTTCTCTGAGGAAGGGGGAGGG + Intronic
1072753291 10:97999607-97999629 GTTTCTGAGAAGAAGGGGGCAGG + Intronic
1075860094 10:125667679-125667701 CTCTACCAGAAGAAGGATGATGG - Intronic
1076145425 10:128115449-128115471 CTTGACCAGAACAAGGGGAAGGG - Exonic
1077493149 11:2871378-2871400 CTTTATTAGGAGACTGGGGAGGG - Intergenic
1078126926 11:8575037-8575059 CTGTCTCAAAAAAAGGGGGAAGG + Intronic
1078320051 11:10326484-10326506 CTATACCATAGGAAGGGGGAAGG - Intronic
1079545830 11:21630664-21630686 ATTCAGCAGAAAAAGGGGGATGG + Intergenic
1079551331 11:21702333-21702355 ATTTGTCTGAAGATGGGGGAAGG - Intergenic
1083160619 11:60852093-60852115 TTTTACCAGATGATGGGGGAGGG - Exonic
1084570579 11:69957198-69957220 GTTTGTCAGAGGCAGGGGGAGGG - Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1085577370 11:77618776-77618798 CTGTATCAGAAGAAAAGAGAAGG + Intronic
1087141728 11:94770598-94770620 CATTTTAAAAAGAAGGGGGAGGG - Intronic
1088541821 11:110921029-110921051 CTTTTGCTGAAGAAAGGGGAAGG - Intergenic
1088546406 11:110963844-110963866 CTTCATCAGGTGAAGGGGCAGGG - Intergenic
1089100997 11:115962333-115962355 CTTTTCCAGAAGACTGGGGAGGG - Intergenic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1091736014 12:2922688-2922710 CTCTGTCAGAAGAAGAGGGTGGG - Intronic
1092815678 12:12310517-12310539 TGTTAACAGAAGAAAGGGGAAGG + Intergenic
1093688373 12:22082304-22082326 CTTTAAGAGAAGAAAGGGCAGGG - Intronic
1095986592 12:48003530-48003552 CTTTATCAGAAGAGAGGCGCAGG + Intronic
1096625399 12:52892392-52892414 CATTACTAGAAGAAGGGGGAAGG + Intergenic
1097811393 12:64023058-64023080 CTTTATCAGTGAAATGGGGATGG + Intronic
1098071686 12:66682454-66682476 TTTTATCATAAGAAGGGGGTGGG + Intronic
1098501839 12:71202090-71202112 CTTTATGAGAAGGAAGTGGATGG + Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1099464441 12:82965772-82965794 CTGGATCAGAACAAGGGGGAGGG - Intronic
1099612479 12:84891831-84891853 CTATGTCAGAAGAATGGGGGCGG - Exonic
1100389293 12:94133612-94133634 CTTTATGAGAAGAACAGGGATGG + Intergenic
1101495904 12:105253959-105253981 TGTTACCAGAAGAAGGGGGATGG + Intronic
1102485062 12:113249930-113249952 CCATTTCAGAAGAAGGGTGATGG - Intronic
1102853400 12:116272642-116272664 CTTTGTGAGAAGAATGGGCAAGG - Intronic
1102924222 12:116814583-116814605 CTGGAGCAGAAGAAGGGGCAGGG + Intronic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103279987 12:119749508-119749530 CATAATCAAGAGAAGGGGGAAGG + Intronic
1104404546 12:128506641-128506663 CATTTTCAGAGGAAGGGAGACGG - Intronic
1105638499 13:22239482-22239504 CATTATGAGAATAACGGGGATGG - Intergenic
1107204056 13:37760428-37760450 CTTTAATGGAGGAAGGGGGAAGG + Intronic
1107719076 13:43229272-43229294 CTTTATCAGCAGCATGGGAATGG + Intronic
1107867595 13:44717909-44717931 CTATATTGGAAGAATGGGGAAGG - Intergenic
1108962104 13:56247216-56247238 CTTTATCTGTGGAAAGGGGAGGG - Intergenic
1109405527 13:61893516-61893538 CTTTATCACAACATGGTGGAAGG - Intergenic
1109873196 13:68364465-68364487 CTTTTTCAAAAGAAGGGTAAGGG - Intergenic
1109933044 13:69242609-69242631 CTTTCTCAGAAGAGGAGGTAAGG + Intergenic
1110175478 13:72550734-72550756 CTTTCTCATAAAAAGGTGGAGGG - Intergenic
1110907355 13:80908756-80908778 CTTTTTCAGAAGATGGAGAAAGG + Intergenic
1112218177 13:97457938-97457960 ATCTATGAGAAGAAGGGGCAGGG + Intronic
1112490686 13:99860614-99860636 CTTTAACTTAAGATGGGGGAGGG + Intronic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113093049 13:106635175-106635197 TTTCATCAGAGGAAGGGGCAGGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113461892 13:110487992-110488014 CTTTGTGGGAGGAAGGGGGAGGG - Intronic
1114298407 14:21351594-21351616 CTTTAAGAGAAGAAGGGGGGAGG - Exonic
1114400200 14:22403002-22403024 CTTTATCAGTTGAAGAGGGCAGG + Intergenic
1115099004 14:29675407-29675429 GGTTGTCAGAAGAATGGGGATGG - Intronic
1115470351 14:33762424-33762446 CTTTAAAATAAAAAGGGGGAGGG + Intronic
1118620423 14:67609779-67609801 CTTGAAGAGAAGAAGGGGAAGGG + Intergenic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1120692184 14:87605190-87605212 CTTTATCAGAAGCATGAAGATGG - Intergenic
1122263416 14:100535697-100535719 CTTCTGCAGAGGAAGGGGGAGGG + Intergenic
1123948924 15:25252157-25252179 CTCCATGAGAAGAAGTGGGAAGG - Intergenic
1125751830 15:42034465-42034487 TCTTATCAGAGGAAGGGGAAAGG - Intronic
1125956853 15:43796425-43796447 CTGTATGAGATGAAGGGGGTGGG - Exonic
1126354384 15:47779847-47779869 CTTTTTAAAAAGTAGGGGGAGGG - Intergenic
1127939884 15:63684249-63684271 GTTTATCAGGAGAAAGGTGAGGG - Intronic
1128377336 15:67086565-67086587 CTTTCACAGATGAAGGGGGATGG + Intronic
1128985447 15:72217234-72217256 CTTTGTCAGGACAAGAGGGAAGG + Intronic
1128987633 15:72232567-72232589 CTCTATCAGAGAAAGAGGGATGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129700898 15:77768235-77768257 CTTTATGAGAAGGGAGGGGAGGG - Intronic
1131365196 15:91833198-91833220 CCCTTTCAGCAGAAGGGGGATGG - Intergenic
1131503313 15:92992130-92992152 GTTTATCAGAAGAAAGAGAAGGG - Intronic
1131510324 15:93046212-93046234 CTTTATAAGAAGGAGGCAGAGGG + Intronic
1133691507 16:8220250-8220272 CTTTATCAGAAGGAGGGATGGGG - Intergenic
1134032838 16:11006308-11006330 GTTTATCAGAAGCAAGGGGCAGG + Intronic
1135500344 16:22990678-22990700 TTTTATCCAAAGAAGGGAGAAGG - Intergenic
1135928096 16:26712842-26712864 TTTTACCAGAAGAAGGAAGATGG + Intergenic
1136077589 16:27827663-27827685 CTTCATCAGAAGAAGGTGTCTGG + Intronic
1136597688 16:31262819-31262841 CCTTTCCAGAAGAAGGGGGCTGG + Intronic
1137737187 16:50733614-50733636 CTTTAACAGAAGGATGGAGAAGG + Intergenic
1137888613 16:52133790-52133812 CTTTAACAGAGGAACTGGGAAGG + Intergenic
1138979972 16:62256215-62256237 CTGTATGAGAAGAAACGGGAAGG + Intergenic
1139466672 16:67157752-67157774 TTTTGTCAGAAGATGGAGGAAGG - Intronic
1140986511 16:80162962-80162984 AGTTTTAAGAAGAAGGGGGAAGG - Intergenic
1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG + Intergenic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1145275954 17:21430606-21430628 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1145313800 17:21716519-21716541 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1145712242 17:26988493-26988515 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1145772818 17:27505614-27505636 CTTTATCAGTAAAATGGGGATGG + Intronic
1147710517 17:42460382-42460404 CATTGTCAGTAGAAGGGAGAAGG + Intronic
1148345517 17:46901002-46901024 ATTAATCAGATAAAGGGGGAAGG + Intergenic
1148510818 17:48168143-48168165 TCTTATCAGAATAGGGGGGAAGG - Intronic
1148799177 17:50212340-50212362 CTTCTTTAGATGAAGGGGGAGGG - Intergenic
1149279974 17:55092746-55092768 TTTTATGAGAAAAAGGGGAAAGG + Intronic
1149354811 17:55828745-55828767 CAATAGCAGAAGATGGGGGAGGG + Intronic
1149507879 17:57211122-57211144 CTTCAGCAGAAAAAGGTGGAGGG + Intergenic
1149802260 17:59580783-59580805 CTGTTTCAAAAGAAGGGGGCTGG + Intronic
1149844231 17:59994706-59994728 CTGTTTCAAAAGAAGGGGGCTGG - Intergenic
1149959174 17:61088511-61088533 CTTTATCAAAAGAAGGGCACAGG - Intronic
1152044562 17:77927529-77927551 CTTCCTCAAAAGAAGGGGGCTGG + Intergenic
1152989582 18:350410-350432 CTTTATCAGCAGCATGGGAACGG + Intronic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1154227193 18:12516169-12516191 CTTTATCAGAGGAAGGAGCAGGG - Intronic
1156897024 18:42257358-42257380 CTTTATCCAGAGAAGAGGGAGGG - Intergenic
1157029591 18:43889667-43889689 GTCTATGAGAAGAAGGGAGAAGG + Intergenic
1157751918 18:50186766-50186788 CTTTATCTGAAGAATTGGGGTGG - Intronic
1158084836 18:53638898-53638920 CTGTAGCAGAAGAAGTGAGATGG + Intergenic
1158548020 18:58412193-58412215 AGCTATTAGAAGAAGGGGGATGG - Intergenic
1159195252 18:65105170-65105192 CTTTATCAGAATTTGGAGGAAGG - Intergenic
1159196763 18:65125812-65125834 CTTGATAATTAGAAGGGGGAAGG - Intergenic
1159278961 18:66259256-66259278 CCTTATCAGAAGAGAGGGAAGGG + Intergenic
1160614100 18:80110522-80110544 CTTTATCAAAAGAGGGGGTTTGG + Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1164500342 19:28814455-28814477 CTTTATAAGAAGAGGAGAGAGGG - Intergenic
1166208623 19:41290669-41290691 CTTTATCAAAAAAAGGGGGGCGG - Intronic
1167730750 19:51252569-51252591 TTTAAACAGAAGAAAGGGGAAGG + Intronic
925210297 2:2039661-2039683 CTTTAACAGAAGACTGGTGATGG + Intronic
925619034 2:5772614-5772636 CTTTGTCAGAGGAGGAGGGAAGG + Intergenic
927410815 2:22824230-22824252 CAATTTGAGAAGAAGGGGGAAGG + Intergenic
927642650 2:24855195-24855217 CTTCCTAAGAAGAAGGGGGTGGG - Intronic
927686083 2:25171531-25171553 CTTAATTATAAAAAGGGGGAGGG - Intergenic
927854716 2:26520728-26520750 CTTTATAAAATGAAGAGGGAAGG + Intronic
928691589 2:33805051-33805073 CCTTACCAGAAGAAGGAGAAAGG + Intergenic
929200292 2:39228142-39228164 CTTTATCTGAAGACTTGGGACGG + Intronic
931658439 2:64532352-64532374 CTTTATCACAAGAAGAGGATTGG + Intronic
933808009 2:86014145-86014167 CTTGATCAGTAGAAGTGGGGAGG + Intergenic
936155806 2:110046862-110046884 CTTTTTCAGAGGAAGTTGGAGGG - Intergenic
936188882 2:110324566-110324588 CTTTTTCAGAGGAAGTTGGAGGG + Intergenic
938002827 2:127758618-127758640 CTTTATGAGTATAATGGGGAGGG + Intronic
938321557 2:130369748-130369770 CTTTATCTGAGTAAGGGGGGTGG - Exonic
939748153 2:146003978-146004000 CTTTATCAGAAGAAAGGACAGGG - Intergenic
939760172 2:146165758-146165780 TTTTATCAGGAGAAGTGGAAGGG + Intergenic
941652778 2:168111260-168111282 CTTAATCTGAAGAAAGTGGAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
943885536 2:193212343-193212365 CTTTATCCAAAGAAGGGGAAAGG + Intergenic
944076029 2:195731790-195731812 GTTTATTAGAAGCAAGGGGAAGG + Intronic
945399729 2:209366466-209366488 CTTTATTAGAAGAAATGGGCGGG + Intergenic
945587923 2:211690308-211690330 CTTTAGCAGAGGTAAGGGGAAGG - Intronic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
946464894 2:219903155-219903177 CTTTATCCAATGAAGGTGGAAGG - Intergenic
948012278 2:234658801-234658823 CTTTATCAAAAGAACGGCGAGGG + Intergenic
1168881185 20:1207542-1207564 TGTTATCAGATGAAGGGGAATGG - Exonic
1170380706 20:15756688-15756710 TTTTATCATCTGAAGGGGGAAGG + Intronic
1170553740 20:17499070-17499092 CTCTTAGAGAAGAAGGGGGATGG - Intronic
1170796606 20:19552873-19552895 CTTCATCAGAGGAAAGGGGAGGG + Intronic
1171347882 20:24479521-24479543 CATTATCAGAGGAAGGGGCATGG - Intronic
1171507168 20:25646931-25646953 CTTTCTCAGTTGAAGGGGAAAGG + Intergenic
1172583584 20:36066530-36066552 CTGTACCAGAATAAGGGGGAAGG + Intergenic
1173546379 20:43901405-43901427 GTTTATGTGAAGCAGGGGGATGG + Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1177442115 21:21139132-21139154 CTTTATAAGAAAAAGGCAGAGGG + Intronic
1177697495 21:24592276-24592298 TTTTATCAGATGAAGGGAAAGGG + Intergenic
1178085235 21:29105556-29105578 ATTTATCTGGAGAAGTGGGATGG + Intronic
1179942991 21:44651613-44651635 CCTTATCAGAAGGAGGGAGGAGG - Intronic
1180974360 22:19839120-19839142 ATGGATCAGAAGGAGGGGGAGGG + Intronic
1181609791 22:24004705-24004727 CTTTTCGAGGAGAAGGGGGAAGG - Intergenic
1181988471 22:26818565-26818587 CTTTATAAGAAGCAGGCAGAGGG + Intergenic
1182041181 22:27240014-27240036 CTTAATCAGAAGAAGGTGAGAGG - Intergenic
1182229403 22:28825809-28825831 ATATATTAGGAGAAGGGGGAAGG + Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
950711022 3:14812764-14812786 CTTTATCTGAAAAATGGGGTTGG + Intergenic
951986571 3:28628018-28628040 CTTTCTCAGAAGAGGAGGTAAGG - Intergenic
952441585 3:33335843-33335865 CTGTCTCAGAAGAAGCGGGCAGG + Intronic
953477492 3:43218049-43218071 CTTCTTTAGAAGAAGGGGGGCGG - Intergenic
955611404 3:60761066-60761088 TATAACCAGAAGAAGGGGGAGGG + Intronic
955766694 3:62351579-62351601 CCCTATTAGAACAAGGGGGAGGG + Intergenic
956174942 3:66464153-66464175 GATTATCATAAAAAGGGGGATGG + Intronic
957245498 3:77711359-77711381 CTTTATAAGAAAAAGGCAGAGGG - Intergenic
961308333 3:125975473-125975495 TTCCCTCAGAAGAAGGGGGAAGG + Intronic
962108742 3:132419655-132419677 CTCAATCAGAAGCAGGGGAAAGG - Intronic
962233779 3:133691042-133691064 ATTTATAAGAAAAAGTGGGATGG + Intergenic
964374144 3:156033104-156033126 ATTTATCAGAAAAATGGGGAGGG - Intergenic
964404050 3:156330125-156330147 CTTTATTATAAAAGGGGGGATGG - Intronic
965750379 3:171969479-171969501 CTTTACCAGTGGAAGAGGGAAGG + Intergenic
967213526 3:187190590-187190612 CTTATTCTGAAGAAGGGGCAAGG - Intergenic
967348084 3:188480951-188480973 TATGATTAGAAGAAGGGGGAAGG - Intronic
967475955 3:189918981-189919003 CTTTGTCATAAGAAATGGGATGG + Intergenic
968099754 3:195956721-195956743 CTGAATCAGAAGATCGGGGATGG + Intergenic
968677565 4:1892327-1892349 CACTCTCAGAAGCAGGGGGAAGG - Intronic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
969030664 4:4210519-4210541 CTTTATAAGAAGAGGAGAGAAGG - Intronic
969104444 4:4794628-4794650 CATTTTCAGAAGAAGCAGGATGG - Intergenic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
973827613 4:54724402-54724424 CTTTATCACAACAAGTTGGAAGG + Intronic
973895178 4:55405062-55405084 CTTTATTCAAAGAAGGTGGAGGG - Intronic
974433500 4:61828838-61828860 ATTTAACAGGAGAAGGGGCAGGG - Intronic
976849568 4:89529671-89529693 TCCTACCAGAAGAAGGGGGAAGG - Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
978475976 4:109130537-109130559 TTTTATCAGTAAAAAGGGGAAGG + Intronic
978570847 4:110135308-110135330 CTTTATCTGCAAATGGGGGATGG - Intronic
979399703 4:120233472-120233494 CTCTATCAGAAGAAGAGCAAGGG + Intergenic
980405489 4:132349809-132349831 ATTTATTAGAAAAAGGGAGATGG - Intergenic
983515480 4:168651706-168651728 CTTTACAAGAAGAAGAGGTAGGG + Intronic
984942541 4:184946270-184946292 CTTTTTCAGAAGATGGAGGCTGG - Intergenic
986231582 5:5869101-5869123 CTTTATAAGAGGAAGGCAGAGGG - Intergenic
986685642 5:10273357-10273379 CTTTTACAGAAGAAGGGGTGGGG + Intergenic
986685933 5:10275201-10275223 CTTTTACAGAAGAAGGGGTGGGG + Intergenic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
988704046 5:33706184-33706206 GTTCATGAGATGAAGGGGGAAGG - Intronic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989483325 5:41958559-41958581 GGTTACCAGAAGAAGGGGGATGG - Intergenic
989559045 5:42830019-42830041 CTTTAACAGCAGAAGGGGCTGGG - Intronic
990288852 5:54328470-54328492 TTATATCAGAAGTAGGGGAATGG + Intergenic
990611036 5:57457083-57457105 CTTTATCAGAAAAAGGATGTAGG - Intergenic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
992091232 5:73319108-73319130 CTTTATCAAAATAAGGAGTATGG + Intergenic
992426336 5:76661891-76661913 CTTTATCAGAGCAAGGGGAAAGG + Intronic
992832606 5:80609033-80609055 CTTGCTCACAAGAAGGGAGAGGG + Intergenic
994714440 5:103304912-103304934 TATTATCAAAAGAAGGGGAATGG + Intergenic
998344013 5:141444912-141444934 CTTTATCAGGGAAAGAGGGAAGG + Intronic
998411898 5:141917564-141917586 CTGTGTCAGAAGAAAAGGGATGG + Intergenic
999683821 5:154084697-154084719 CTTAATCAGCAAAATGGGGATGG - Intronic
1000070105 5:157732441-157732463 CTGTCTCAGAAAAAGAGGGAGGG + Intronic
1001565150 5:172695291-172695313 CATTGTCAGGAGGAGGGGGAGGG + Intergenic
1008250623 6:49235448-49235470 CTTCATGAGAAAAAGGAGGAAGG - Intergenic
1008669412 6:53751934-53751956 CTTTATTAGCAGAAGGGAGGAGG + Intergenic
1010166464 6:72920285-72920307 CTATATCAAAAAAAGGGGGGAGG + Intronic
1010928358 6:81770663-81770685 CTTTATAAGAAGAAGAGTGAGGG - Intergenic
1011603674 6:89081599-89081621 CTTTGGGGGAAGAAGGGGGAAGG + Intronic
1012177472 6:96106269-96106291 TTTTGTCAGAAGAATTGGGAGGG + Intronic
1015301281 6:131655527-131655549 ATTCATCAGAAGAACGGGTAAGG + Intronic
1016530494 6:145053999-145054021 CTTTATGAGAAGACAGGGGTTGG - Intergenic
1017916881 6:158838024-158838046 CTTTTCCAGAGGGAGGGGGAAGG + Intergenic
1019064864 6:169288291-169288313 CTTTATGAGAGGCAGGTGGAAGG - Intergenic
1021551082 7:21871786-21871808 CTTTATGAGAAGAAGGGATTAGG - Intronic
1023011888 7:35931185-35931207 ATTTATCAGAAGAAAGAGAAAGG + Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023651970 7:42380696-42380718 CTTTATCAGAATAAGACTGAAGG - Intergenic
1023805677 7:43871243-43871265 CCTAATCAGAGGAAAGGGGAAGG + Intronic
1024079247 7:45842683-45842705 ATTTATCAGAAGAAAGAGAAAGG - Intergenic
1025125533 7:56341266-56341288 ATTTATCAGAAGAAAGAGAAAGG + Intergenic
1029985323 7:104917518-104917540 CATTATTAGAAGATGGGGGGTGG + Intergenic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030561669 7:111094697-111094719 CTTTATCAGAAGGAGAGGAGAGG - Intronic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1032011279 7:128349805-128349827 GTTCTTCAGGAGAAGGGGGAGGG + Intergenic
1033921275 7:146395336-146395358 CTTCACCAGAAGCAGAGGGAAGG + Intronic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1036803366 8:11809095-11809117 CTTTCAGAGAAGAGGGGGGAGGG + Intronic
1038245109 8:25848157-25848179 CTTTAAAAGAAGAAGGGGCCAGG - Intronic
1038556123 8:28518662-28518684 CTAAATGAGAAGAAGTGGGAAGG - Intronic
1039594097 8:38775550-38775572 ATTTGGCAGAAGAAGGGAGAGGG + Intronic
1040635735 8:49270784-49270806 CTTGACCAGAAGTCGGGGGAGGG - Intergenic
1041107251 8:54455190-54455212 TGTTATAAGAAGTAGGGGGAGGG + Intergenic
1042229773 8:66544005-66544027 TTTTATCAGAGTAAGAGGGAAGG + Intergenic
1043128526 8:76431451-76431473 CTTTGTCAGATGAAGCGAGACGG + Intergenic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1044743748 8:95352748-95352770 CTTTATGAGAAGAAAGGGGGAGG - Intergenic
1045061949 8:98418528-98418550 CTTTCACAGCAGAAGGGCGAGGG + Intronic
1045297499 8:100884853-100884875 CTTTAACAGAGGTAGGAGGAGGG - Intergenic
1045375868 8:101573705-101573727 CTCCGTCAGAAGCAGGGGGAGGG + Exonic
1045685924 8:104712261-104712283 CTCTATCAGAGGAAAGGGTATGG + Intronic
1045893514 8:107186044-107186066 TATTATGAGAAAAAGGGGGAAGG + Intergenic
1046149447 8:110203197-110203219 GTTTATGAGAGGCAGGGGGATGG + Intergenic
1051245019 9:15101304-15101326 TGTTATCAGCCGAAGGGGGAAGG - Intergenic
1051421968 9:16897712-16897734 CTTTATTAGAAGCAGGAGAATGG - Intergenic
1051690074 9:19702363-19702385 CTTTATCAGAATAACTGAGATGG - Intronic
1052155256 9:25179500-25179522 CTTTCACAGCAGAAGGGAGAGGG + Intergenic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1055809160 9:80131541-80131563 CTGTCTCAGAAGAAAGGGGGTGG + Intergenic
1057913562 9:99038497-99038519 CTGTTTTATAAGAAGGGGGAGGG + Intronic
1058173472 9:101711072-101711094 CATTATCACAAGAAGGACGAGGG - Intronic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1058566840 9:106294846-106294868 CTATATTAAAGGAAGGGGGAGGG + Intergenic
1061529825 9:131201921-131201943 CTTTCTCAGAAGACTGTGGAAGG - Intronic
1062658381 9:137615534-137615556 CTTTAACAGAGGACGGGGGCTGG + Exonic
1185895132 X:3851670-3851692 ATTTATCAGAGGAGAGGGGATGG - Intergenic
1185900250 X:3890095-3890117 ATTTATCAGAGGAGAGGGGATGG - Intergenic
1185905366 X:3928526-3928548 ATTTATCAGAGGAGAGGGGATGG - Intergenic
1186683468 X:11900199-11900221 TTTTGTCTGAAGAAGGGGGAAGG + Intergenic
1187370268 X:18699667-18699689 CTTCATCAGCAGAAAGGGAAAGG - Intronic
1187520788 X:20012094-20012116 GTTTTTCAGGAGAAAGGGGAAGG - Intronic
1189105836 X:38234253-38234275 CTTTAGGAAAAGAAGGGGAAAGG - Intronic
1191025627 X:55909851-55909873 CTTTAACAGTGGAAGGGAGATGG - Intergenic
1192443959 X:71196188-71196210 TTCTATCAGAAGAAGGGGTTGGG + Intergenic
1193142344 X:78041222-78041244 ATTTATTAGAAGAGGGGAGAAGG - Intronic
1193578612 X:83233375-83233397 CTTTATCAGAAGAAAGGTCTAGG - Intergenic
1194663111 X:96647924-96647946 ATTTAACAGATGGAGGGGGAAGG - Intergenic
1194825390 X:98556293-98556315 CTTTATTAGAAGCATGAGGATGG - Intergenic
1196555191 X:117077444-117077466 CTTTATCACAGGAAAGGAGAAGG + Intergenic
1198019811 X:132646733-132646755 CTTTATCAGCAGCATGGGAATGG - Intronic
1198889245 X:141374363-141374385 CTTTATCAGCAGCATGGGAACGG + Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199779306 X:151043839-151043861 TGTTGTCAGAAGAAGGAGGAAGG + Intergenic