ID: 1199737542

View in Genome Browser
Species Human (GRCh38)
Location X:150697660-150697682
Sequence CGTGTGACCTTGGGCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199737537_1199737542 -6 Left 1199737537 X:150697643-150697665 CCTGACCACTTGCCAGTCGTGTG 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1199737542 X:150697660-150697682 CGTGTGACCTTGGGCAAAACTGG 0: 1
1: 0
2: 1
3: 28
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199737542 Original CRISPR CGTGTGACCTTGGGCAAAAC TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901022642 1:6262856-6262878 CGTGTGGCTTTGGGCAAACCAGG - Intergenic
901085826 1:6611816-6611838 AATATGACCTTGGGCAATACAGG + Intronic
901514424 1:9735419-9735441 CAAGTGTCATTGGGCAAAACAGG + Intronic
901784758 1:11617246-11617268 GGTGTGGCCTTGGGCAAGTCAGG - Intergenic
902431933 1:16370070-16370092 TGTGTGATCTTGCGCAAAACAGG - Intronic
902675533 1:18006125-18006147 CATGTGGCCTTGAGCAGAACAGG - Intergenic
905593665 1:39187093-39187115 CGTGTGACTTTGGGAAGAAGGGG - Intronic
908005052 1:59718995-59719017 GGTGTGACCTTGAACAAAAGAGG - Intronic
910227472 1:84950752-84950774 TGTGTGATCTTGGGCAAACCTGG - Intronic
910562449 1:88605849-88605871 CATATGACCTTGGGCAAATCAGG - Intergenic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
911057358 1:93720398-93720420 TGTGTGCTCTTGGGCAAAACAGG + Intronic
913060371 1:115199193-115199215 TGTGTGACCTTGGGCAAGTCAGG + Intergenic
1062788058 10:281692-281714 CGTGTGATCTTGGGCAGACGAGG - Intronic
1064015045 10:11765201-11765223 TGTTTGACCTTGGACAAAGCTGG - Intergenic
1066746136 10:38605061-38605083 CGTGTGACCGTGGGTACCACTGG - Intergenic
1072156068 10:92724872-92724894 GGTGTGACCTTGATCAAAATGGG + Intergenic
1081604443 11:44518587-44518609 GGTGTGACCTGGGGCAAGTCAGG + Intergenic
1081936650 11:46908951-46908973 CTTGTGACCTTGGCCAAAGCGGG - Intronic
1083339072 11:61946925-61946947 TGTGTGACCTTGGACAAGGCAGG + Intergenic
1083655172 11:64226040-64226062 CGTGTGACCTTGGGCAAGTCTGG - Exonic
1085076070 11:73593823-73593845 TGTGTGACGTTGGGCACAATGGG - Intronic
1086850758 11:91804679-91804701 AATGTCACCTTGGGCAAATCGGG + Intergenic
1091603745 12:1933709-1933731 TCTGTGACCTTGGCCACAACAGG - Intergenic
1091841344 12:3623544-3623566 CGTGTGGCCATGGGACAAACTGG - Intronic
1095220945 12:39613722-39613744 TGTGTGACTTTAGGCAAAGCTGG + Intronic
1097459839 12:59847777-59847799 TGTGTGACCTTGGGAAAAGTAGG - Intergenic
1101535382 12:105611807-105611829 CATGTGACCTTGGGCAAGTCAGG + Intergenic
1103972194 12:124679268-124679290 GGTGTCCCCTTGGGCAAAATGGG + Intergenic
1107631974 13:42351566-42351588 CTTGTGATCTTGGGTAAATCTGG - Intergenic
1117772544 14:59149567-59149589 GCTCTGACCTTGGGCATAACTGG + Intergenic
1118596914 14:67442816-67442838 CATGTGACCTTAGGGAAAACAGG + Intergenic
1119399577 14:74353329-74353351 ATTGTGACCTTGGGCAAATTAGG + Intronic
1124557929 15:30745314-30745336 CTTGTGACCTTGGGCAAGCGTGG - Intronic
1126985376 15:54300792-54300814 TTTGTGACCTTGGACAAACCAGG - Intronic
1128385414 15:67144786-67144808 GCTGTGACATTGTGCAAAACTGG - Intronic
1133468627 16:6052302-6052324 TGCGTGACCTTGGGCAAAATGGG - Intronic
1133670802 16:8017693-8017715 GGTGTTAACTTGGGGAAAACTGG + Intergenic
1133693846 16:8241981-8242003 TGTGTAATCTTTGGCAAAACAGG - Intergenic
1134026556 16:10958370-10958392 TATGTGACCTTGAGCAAAAAAGG - Intronic
1134824137 16:17270934-17270956 CGAGTGACCTTGGGCAAGCCTGG - Intronic
1139729284 16:68928842-68928864 AGTGGGGCGTTGGGCAAAACTGG + Intronic
1140237690 16:73173739-73173761 CTTGTGACTTTGGCCAAACCTGG - Intergenic
1141606973 16:85159319-85159341 TGTGTGACCTTGGTCAAGTCAGG + Intergenic
1142123784 16:88400225-88400247 CGTGTGAGCTAGGGCAGAACCGG - Intergenic
1143323512 17:6083256-6083278 CATGTGACCTTGGGCATAGTGGG + Intronic
1144283168 17:13746661-13746683 CATCTTACTTTGGGCAAAACTGG + Intergenic
1145210814 17:21011670-21011692 CCTGTGACCCTAGGCAACACTGG + Intronic
1146927218 17:36753378-36753400 CCTGTGACCTTGAGCAAGGCTGG - Intergenic
1153686976 18:7556156-7556178 AGTGTGACCTTGGGACACACAGG - Intergenic
1154142296 18:11834913-11834935 CAAGTGGCCTTGGGCAAAGCAGG + Intronic
1157607275 18:48933683-48933705 AGTGTGACCTAGCGCAGAACAGG - Intronic
1158046748 18:53165192-53165214 TGTGTGACCTTGAGCAAGTCAGG - Intronic
1158914674 18:62111151-62111173 CATGTGTCCTTGTGGAAAACAGG + Intronic
1160067283 18:75587453-75587475 CTGGTGAACTTGGGCACAACTGG - Intergenic
1160422183 18:78754810-78754832 CATGTGACCTGGGGCAGGACAGG - Intergenic
1160797551 19:952947-952969 CCTGTGACCTTGGGCACTGCTGG + Intronic
1163038140 19:14583452-14583474 AGTGTGACCTGGGGGAATACAGG + Intronic
1163038829 19:14587709-14587731 AGTGTGACCTGGGGGAATACAGG + Intronic
1163039575 19:14592376-14592398 AGTGTGACCTGGGGGAATACAGG + Intronic
1163526288 19:17823626-17823648 CCTGTGACCTTGGGCAAGTTTGG - Intergenic
1168297138 19:55382974-55382996 TGTGTGGCCTTGGGCAAATGTGG + Intronic
925181103 2:1817387-1817409 CGTGAGACTGTGGGCAAAGCCGG - Intronic
929395614 2:41518787-41518809 GGTGTGACCTTGGGTAAGGCAGG + Intergenic
931994788 2:67829594-67829616 TGTGTGACCTTGGGCAGGAAGGG - Intergenic
932579311 2:72983198-72983220 CGTGTGGCCTTGGGGAGAAGGGG + Intronic
932591963 2:73072801-73072823 ACTGTCATCTTGGGCAAAACAGG - Intronic
932737023 2:74261385-74261407 CCTGTGGCCTTGGGCACAGCAGG - Intronic
937773902 2:125753134-125753156 CGTGTTGCCTTGGCCTAAACAGG + Intergenic
940601299 2:155864423-155864445 TGTGTGTCCTTGGGCTCAACAGG - Intergenic
944860836 2:203814544-203814566 CCTGTGACATTGGGCCAAAATGG - Intergenic
1169149169 20:3275761-3275783 GGTGAGACCTTGGCCAAATCTGG - Intronic
1169155226 20:3323908-3323930 TGTGTGACCTTGGGCAAGATAGG - Intronic
1169287747 20:4323689-4323711 AGTGTGACCTTGCTCTAAACAGG + Intergenic
1170227109 20:14003408-14003430 CGTGTGACCTTGGGCAAGCGGGG + Intronic
1170399556 20:15966289-15966311 CGTGTGACCATGGAGAAAGCTGG - Intronic
1171205139 20:23273230-23273252 CATGTGACCTTGGGCAAGTTAGG - Intergenic
1173042318 20:39475934-39475956 TGTGTGACCTTAGGCAAGACAGG + Intergenic
1174579291 20:51559766-51559788 TATGTGACCTTGGGCAAAGCCGG + Intronic
1179248387 21:39652445-39652467 CCTGTGCCCTTGTGCCAAACTGG - Intronic
1181416861 22:22766245-22766267 TGTGTGACCTTGGACCAGACAGG - Intronic
1181417163 22:22768638-22768660 TGTGTGACCTTGGACCAGACAGG - Intronic
1182041981 22:27245260-27245282 CGTGTGACCTTGGGTTACAGGGG - Intergenic
1182623035 22:31628162-31628184 CCTGTGTCCTGGGGCAAAGCTGG - Exonic
1183362564 22:37390314-37390336 TGTGTGGCCTTGGGCAAGCCAGG - Intronic
1183383562 22:37502645-37502667 CGTGTGGCCTTTGGGAAAGCCGG - Exonic
1183398916 22:37589545-37589567 TGTGTGACCTTGGGCAGGCCAGG + Intergenic
1184235862 22:43182682-43182704 AGGGTGACCTCGAGCAAAACTGG + Intronic
950465175 3:13149267-13149289 TGTGTGGCCTTGGGCAAGCCTGG - Intergenic
950518263 3:13480978-13481000 ACTGTGACCTTGGGCACACCTGG + Intronic
950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG + Intergenic
955326486 3:58012581-58012603 CCTCTGACCTTGGACAAAATAGG + Intronic
955523025 3:59793469-59793491 CATGTGACCTTGGGCAAGGCTGG - Intronic
955705982 3:61728223-61728245 CGTGCGACCTTGAGCAAGTCTGG + Intronic
956343326 3:68250184-68250206 TGTGGAACCCTGGGCAAAACTGG + Intronic
956515740 3:70045795-70045817 TGTGTTACCTTGGGAAAATCTGG + Intergenic
956774371 3:72552737-72552759 TTTGTGACCTTGGGCAAGGCTGG + Intergenic
960898082 3:122527109-122527131 CTTGTGAGCATGGGCACAACTGG + Intergenic
962875464 3:139532774-139532796 AGGGTGACCTTGGGCTAAAAAGG + Intronic
964420147 3:156493642-156493664 CGTGTGATCTTGGCCAGAAAAGG - Intronic
969938320 4:10705289-10705311 GGTGTGACCTGGGGAAACACTGG + Intergenic
973160576 4:47011223-47011245 GGTGAGGTCTTGGGCAAAACAGG - Intronic
974906484 4:68064549-68064571 TGTGTGGCCTTGGGCAGAACAGG - Intronic
975769696 4:77708021-77708043 GGCATGACCTTGGGCAAGACAGG + Intergenic
976627876 4:87206564-87206586 TGTGTGGCCTTGGGCAAGTCAGG - Intronic
978171974 4:105683007-105683029 CCTCTAACCTTGGGTAAAACTGG - Exonic
978273855 4:106924915-106924937 CAAGTGACCTTGGACAAAACTGG + Intronic
981748797 4:148074214-148074236 TATGTGACCTTGGGCAAGATCGG + Intergenic
983249764 4:165330503-165330525 CCTGTGACCTTGGGCAAATTAGG - Intronic
984475460 4:180229228-180229250 CAGGTGACCTTGGTCAACACAGG + Intergenic
985127979 4:186714206-186714228 CGTGTGGGCTGGGGCACAACGGG + Intronic
986809521 5:11341013-11341035 AGTGTTACTTTGGGCAAACCTGG - Intronic
989181231 5:38579279-38579301 CATGTTACATTGGCCAAAACAGG + Intronic
990957613 5:61359344-61359366 CTTGTGACCTTGGGCATCACTGG + Intronic
992720509 5:79556489-79556511 TGTGTGATCTTGGGCAAATCAGG - Intergenic
994675291 5:102813811-102813833 CTTGTGACCTGGGGCAAATAGGG + Intronic
997840869 5:137238045-137238067 TGTGTGATCTTGGGCAAGACTGG + Intronic
997983999 5:138489425-138489447 GTTTTGACCTTGAGCAAAACAGG - Intergenic
998083994 5:139301172-139301194 TGTGTGACCTTGAGCCAAAAAGG - Intronic
998172668 5:139881688-139881710 CGAGTGCCCTTGGGCAAGTCAGG - Intronic
1001545722 5:172569494-172569516 TGTGTGACCTTGGGCCATCCAGG - Intergenic
1009338606 6:62525757-62525779 AGGGTGACCTTGGACATAACTGG + Intergenic
1013310950 6:108893408-108893430 TGTGTGACCTTGGGCACATCTGG + Intronic
1017821086 6:158049501-158049523 AGTGAGGCCTTGGGCAAAAGTGG - Intronic
1020043608 7:5023015-5023037 CGTGTGACCTTAGGAATCACGGG - Intronic
1021773874 7:24032434-24032456 TGTATGACCTTGGGCATACCAGG + Intergenic
1029260354 7:99298082-99298104 CGCGTGACGTTGGGCAATTCAGG + Intergenic
1029318930 7:99740017-99740039 TGTGTGTCCTTGGGCAAGGCTGG - Intergenic
1032146824 7:129390761-129390783 CGTGTCTCATTGGGCAGAACTGG + Intronic
1032483944 7:132268898-132268920 CGTGTCCCCTTGCTCAAAACAGG - Intronic
1033287679 7:140056743-140056765 TGTGTGACTTTGGGCAAGTCTGG - Intronic
1034627492 7:152504618-152504640 CCTATGGCCTTGGGGAAAACTGG + Intergenic
1046949164 8:120003446-120003468 GGCATGACCTTGGGCAAAGCAGG + Intronic
1048009050 8:130442300-130442322 CATGTGATCTTGGGCAAGTCAGG + Intronic
1048691589 8:136971000-136971022 TGTATGACCTTGGGCAAGAGAGG + Intergenic
1048797321 8:138163204-138163226 CGTGTGAAATTGGGCAAAAGGGG - Intronic
1048982636 8:139711176-139711198 TGTGTGACCTTGGGCAAGTGAGG + Intergenic
1051865165 9:21672207-21672229 CCTGTGACATTAAGCAAAACAGG + Intergenic
1057695560 9:97320557-97320579 TGTGTGACCTTGGGAAAATCAGG + Intronic
1058860595 9:109114501-109114523 TTTGTGACCTTGGGCAGACCAGG - Intronic
1059308786 9:113374374-113374396 CGTGGGACCTGAGGCAGAACTGG - Exonic
1187304207 X:18080584-18080606 CATGTGACTTTTGGGAAAACAGG + Intergenic
1195756020 X:108199435-108199457 TGTGTGACCTTGGCCAAATCAGG - Intronic
1197456603 X:126683760-126683782 ACTGTGACCTTGAACAAAACAGG + Intergenic
1199419155 X:147623089-147623111 AGTGAGACCTTGGGCACTACAGG - Intergenic
1199737542 X:150697660-150697682 CGTGTGACCTTGGGCAAAACTGG + Intronic