ID: 1199739027

View in Genome Browser
Species Human (GRCh38)
Location X:150715150-150715172
Sequence CAGGGTCACCAAAGGAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199739027_1199739035 19 Left 1199739027 X:150715150-150715172 CCCACTCTCCTTTGGTGACCCTG 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1199739035 X:150715192-150715214 AGTTTGAAAGCCACTGCTTTTGG 0: 1
1: 2
2: 14
3: 163
4: 650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199739027 Original CRISPR CAGGGTCACCAAAGGAGAGT GGG (reversed) Intronic
900125423 1:1066996-1067018 CAGGGTCCCCAAGGGAGGGGTGG + Intergenic
900687847 1:3959956-3959978 CAGGGACACAAAAGAAGACTCGG - Intergenic
901392628 1:8956971-8956993 CAGGGTCACCAAAGGAGAAGAGG - Intronic
902421871 1:16287131-16287153 CAGAGTGAACAAAGGAGAGGAGG - Intronic
904112140 1:28134473-28134495 CACAGGAACCAAAGGAGAGTTGG - Intergenic
906193229 1:43912566-43912588 TAGAGTCACCCCAGGAGAGTTGG + Intronic
906514477 1:46430954-46430976 CGAGGTCACCCATGGAGAGTGGG + Intergenic
907125841 1:52050159-52050181 CAGCTTCACCAAAGCAGAATGGG + Intronic
908617155 1:65934699-65934721 AATGGTCACCAAAGGAGAAGTGG + Intronic
908814440 1:68017281-68017303 CATGGTCACCACAGGAAATTTGG - Intergenic
912254394 1:108044344-108044366 CAGGGTTCCCAAATGAGAGTTGG + Intergenic
914345431 1:146794673-146794695 CAGGCTTCCCAAAGGAGAGCAGG + Intergenic
914728010 1:150344652-150344674 TAGGGTCATTAAAAGAGAGTAGG - Intronic
914859394 1:151373798-151373820 CAGGGTTTCCAAACCAGAGTGGG + Intergenic
915342636 1:155184785-155184807 CTGGGTCCCCAAGGGAGACTTGG - Exonic
915784017 1:158587528-158587550 CAGGGTAAGCAAAAGAGAGTGGG + Intergenic
918379910 1:183943614-183943636 CAGGCTCACCAAGGGAGTGCTGG - Intronic
923723326 1:236485528-236485550 CCGGGTAACCAAAGGAGATTTGG - Intergenic
924942380 1:248821113-248821135 CAAGGTCACCACAGGAGGGAGGG + Intronic
1066276971 10:33878670-33878692 CCGGGTCACCAAAGCTGAGGTGG - Intergenic
1068663535 10:59648209-59648231 CAGGGTCATCAGAGCAGAGAGGG - Intergenic
1070750572 10:78961813-78961835 CAGGGACACCAAGGCACAGTGGG + Intergenic
1073362656 10:102912545-102912567 CAGCGGCACCCAAGGAGCGTGGG + Intergenic
1073473523 10:103738570-103738592 CAGGGGGACCACAGGAGGGTGGG + Intronic
1076572854 10:131443966-131443988 CAGGGCCAGCAAAGGAGACATGG + Intergenic
1077900513 11:6483680-6483702 CAGGGTCACCTGATGAGGGTGGG - Exonic
1078019366 11:7642438-7642460 CAGGGAGATCAAAGGAAAGTGGG - Intronic
1078391089 11:10935925-10935947 CAGAGTCAGAAAAGGAGAGGTGG - Intergenic
1078713519 11:13817609-13817631 CAAGATCACCAGAGGAGAGAAGG + Intergenic
1080594583 11:33759415-33759437 CAGGGTCCACAAAGGAGAGAGGG + Intronic
1081258898 11:40933675-40933697 CAAGGTCACCCAATGAGAGAGGG - Intronic
1081865246 11:46356141-46356163 GACGGTCACCAGAGAAGAGTGGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1087132689 11:94682191-94682213 TAGGGTTACCAAAGGAGAGAGGG - Intergenic
1089197151 11:116700840-116700862 CAGGAAAACCAAAGGAGAGAGGG - Intergenic
1089459474 11:118644199-118644221 CAGGGTCCCCTCAGGAGAGCAGG - Intronic
1090055290 11:123418280-123418302 CAGGGTTTCCCAAGGGGAGTTGG + Intergenic
1090254885 11:125276646-125276668 CAAGGTCATCAACTGAGAGTGGG + Intronic
1092239182 12:6827045-6827067 CAGGGGACCCAAGGGAGAGTCGG - Exonic
1093209671 12:16293048-16293070 CGAGGTCACTAAAGGAGGGTGGG + Intergenic
1094720035 12:33053217-33053239 CAGGGAGGCCAAAGGGGAGTGGG - Intergenic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1096689980 12:53314554-53314576 CAGGGGCACCATAGGACAGGAGG + Intronic
1098320901 12:69241937-69241959 AAAGGTCACAAAAGGATAGTTGG + Intronic
1102174074 12:110863175-110863197 AAGGGACACCAAAGTAGAGCGGG + Intronic
1104192700 12:126498624-126498646 AAGGGTCCCCAAAGGAGATTTGG - Intergenic
1104855876 12:131902310-131902332 CAGGATCACCAGACAAGAGTAGG + Intronic
1105033083 12:132898383-132898405 GAGGGTCAGCAAAGGGGAGATGG - Intronic
1106177418 13:27343018-27343040 CAGGGACTCCAAAAGAGAGGAGG - Intergenic
1106339657 13:28816739-28816761 CTGGGTCACCAAAAGAGGGGAGG - Intergenic
1106633396 13:31501241-31501263 AATGGTAACCAAAGGAGAGCAGG + Intergenic
1108362691 13:49682053-49682075 CCTTGTCACCAAAGGACAGTAGG - Intronic
1110261527 13:73490649-73490671 CAAAATCACCAAAGGAGAATGGG + Intergenic
1113103907 13:106751486-106751508 CAGGTGTACCATAGGAGAGTTGG + Intergenic
1114874505 14:26698998-26699020 CAGTGTCATCAGTGGAGAGTGGG + Intergenic
1116110125 14:40568283-40568305 CATGGTCACAAAAATAGAGTTGG - Intergenic
1118180651 14:63489216-63489238 TAGGCTCACCAAAGAAGATTTGG + Intronic
1118313537 14:64709647-64709669 CAGGGTCCCAAAAGGAGAGATGG + Intronic
1119762179 14:77159365-77159387 CAGGGTCAGAAAAGGAGATTTGG - Intronic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1123997847 15:25731219-25731241 AATGGTCACCAAAGGAGAACAGG + Intronic
1124016196 15:25877759-25877781 CTGGGTCGTGAAAGGAGAGTAGG + Intergenic
1124989754 15:34660055-34660077 CAGAGTCACCAAAGTGGAGGAGG - Intergenic
1127365370 15:58284428-58284450 CTGGGTGAGCAAAGGTGAGTTGG + Intronic
1128517431 15:68351423-68351445 CAGGGTCATGAAAGGTAAGTGGG + Intronic
1128936238 15:71748765-71748787 GAGGGTCTCCAAAGGTGAGGAGG + Intronic
1130332731 15:82934395-82934417 GAGGGTCACTAAAGGAGCATGGG - Intronic
1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG + Intronic
1132200143 15:99946980-99947002 AACAGTAACCAAAGGAGAGTTGG - Intergenic
1132551197 16:554452-554474 CAGGGAGGCCAAAGGGGAGTGGG - Exonic
1134121453 16:11587184-11587206 CAGGGGCAGGATAGGAGAGTGGG - Intronic
1135281869 16:21159342-21159364 CAGGGAGACCCAAGGAGAGGAGG - Exonic
1135614678 16:23901013-23901035 CAGGATCCCCATAGGAGAGGGGG - Intronic
1135732513 16:24906842-24906864 CAGGGTCAAGAAAGGAGGGCTGG + Intronic
1135902124 16:26470823-26470845 AAGGGTCAACAAAACAGAGTTGG + Intergenic
1135994853 16:27240242-27240264 CAGAGTCACCAAGAGAGACTGGG + Intronic
1136080805 16:27851547-27851569 CAAGGTCACCAGCTGAGAGTGGG + Intronic
1137911432 16:52382043-52382065 CATGGACACCAGAGGAGGGTTGG + Intergenic
1139450163 16:67022984-67023006 CTGGGACACAAAAGGAGAGAAGG + Intergenic
1140819128 16:78647041-78647063 CTGGGTCACAAAGGGAGAGCTGG - Intronic
1140834886 16:78784307-78784329 CAGGGTCACAAAAGGAGTCAGGG - Intronic
1142220310 16:88851054-88851076 CAGGGTCAGCAGATGAGAGCTGG - Intronic
1144745457 17:17611141-17611163 CAGGGTCACAAAACAATAGTGGG + Intergenic
1145013524 17:19382841-19382863 CAGGCACACCAAAGGGCAGTGGG + Exonic
1146077395 17:29744092-29744114 CAGGGACGCCAAAGGGCAGTGGG + Intronic
1146629893 17:34462349-34462371 CAGGGTCATCAAGGGAGTCTGGG + Intergenic
1146913763 17:36665119-36665141 CGGGGTCCCCAAGGGAGAGATGG + Intergenic
1147119061 17:38324821-38324843 TCTGGTCCCCAAAGGAGAGTAGG + Intergenic
1147428365 17:40356891-40356913 CAGGGACATGAAAGGAGAGTGGG - Intronic
1147759829 17:42790333-42790355 GTAGGCCACCAAAGGAGAGTAGG + Intronic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1150219373 17:63487424-63487446 CAGGGTCACGAAAGGAGGCCGGG - Intronic
1150233627 17:63574208-63574230 CAGAGTCTTCAAAGGAGAATAGG - Intronic
1152813571 17:82393855-82393877 CAGAGGCACCAAAGGACAGGGGG + Intronic
1154405237 18:14084572-14084594 CAGGATCACCAGGGGAGGGTGGG + Intronic
1156342766 18:36226339-36226361 AATGGTAACCAAAAGAGAGTAGG - Intronic
1157457253 18:47843423-47843445 CCAGGTCACCCAAGGGGAGTAGG + Intronic
1157941469 18:51933482-51933504 AACGGTAACCAAAGGAGACTGGG - Intergenic
1159755751 18:72361636-72361658 CAGGAACACCAAAGGAGAGAAGG - Intergenic
1159917638 18:74200857-74200879 CAGGGCCACAAAAGGAGAAGGGG - Intergenic
1162322817 19:9979873-9979895 CAGGGTCACCAAGGTAAAGATGG - Exonic
1165102930 19:33449537-33449559 CAGGGTCACAGCAGGAGAATGGG + Intronic
1165189815 19:34053310-34053332 TAGGGTTACCAAAGGAAAGAAGG + Intergenic
1165395312 19:35560624-35560646 CAGGGGCACCAAAGTTGAGGTGG + Intronic
1166214640 19:41327457-41327479 CCGGGTCAGCAAGGGGGAGTGGG - Intronic
1166939501 19:46354164-46354186 CAGGGTCACAAAATGTGAGATGG - Intronic
1167000214 19:46741395-46741417 AAGGGACAGCAAAGCAGAGTGGG - Intronic
1167691462 19:50986593-50986615 CAGAGTGACCAAAGGAGATGAGG + Intergenic
925367832 2:3323299-3323321 CAGGGACACCAAAGGTGATGTGG + Intronic
926826096 2:16906303-16906325 CAGAATCACCAAAGGGGAGGTGG - Intergenic
927336763 2:21933525-21933547 CAGGGTCACCACAGGTAAGTAGG + Intergenic
927353167 2:22142803-22142825 CAGGGTCAGCAAAAGTGATTGGG - Intergenic
929931114 2:46256247-46256269 CAGGGGGACCTGAGGAGAGTTGG + Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930583572 2:53242989-53243011 CTGAGTCACCAATGGAGAATAGG + Intergenic
931548076 2:63410711-63410733 AATGGACACCAAAGGTGAGTAGG + Intronic
937275563 2:120681811-120681833 CTTGCTCACCAAAGGAGAGAAGG + Intergenic
937736812 2:125301212-125301234 AAATGTCACCAAAGGAGAGCAGG + Intergenic
942567732 2:177283153-177283175 CAGGGTGAGGAAAGGGGAGTAGG + Intronic
943088296 2:183342786-183342808 TGGGGTCTCCAAAGGAGAATTGG + Intergenic
943796601 2:192004208-192004230 TGGGGTCTCCAAAGGAGAGGGGG + Intronic
948976527 2:241466761-241466783 CAGGGAGGCCAAAGGGGAGTGGG - Intronic
1169514061 20:6297099-6297121 CAGGGGCACCAAAGGAAGGGAGG + Intergenic
1171445587 20:25201581-25201603 AAGAGTGACCAAAGGAGAGCAGG - Intronic
1171913262 20:30987013-30987035 CAGGTTCACCAAAGGTGAAATGG + Intergenic
1173346542 20:42205666-42205688 CAGTGTCTCCCCAGGAGAGTGGG - Intronic
1175291733 20:57880542-57880564 CAGGGTCACCCAAGCAGGGATGG - Intergenic
1175666476 20:60864376-60864398 CAGGATCTCCAAACCAGAGTGGG - Intergenic
1176002173 20:62837180-62837202 CAGGGTGACCAATGGAGCCTGGG - Exonic
1176668888 21:9713517-9713539 CAGGGAAGCTAAAGGAGAGTGGG + Intergenic
1177512593 21:22109276-22109298 AGAAGTCACCAAAGGAGAGTGGG + Intergenic
1178721848 21:35017371-35017393 AAGGGTGCCGAAAGGAGAGTGGG + Intronic
1180912991 22:19466217-19466239 CAGGGTCACTAGAGGAGTGGAGG - Intronic
1183078192 22:35439869-35439891 CATGGTGCCCAAAGCAGAGTGGG + Intergenic
1185235569 22:49710820-49710842 CAGGGGCACCCAGGGAGGGTGGG - Intergenic
950864729 3:16179969-16179991 CAGGATGATCAAAGGAGAGCTGG - Intronic
953855970 3:46499305-46499327 CAAGGTCACCGAAGCAGAGGAGG + Intronic
956445729 3:69323967-69323989 CAGACTCACCAAACCAGAGTTGG + Intronic
959427761 3:106214030-106214052 AAGGGTAACCAAAGTAGGGTGGG + Intergenic
962595150 3:136934647-136934669 AAGGGTGGGCAAAGGAGAGTAGG - Intronic
967190382 3:186979500-186979522 GATGGTCCCCAAAGGAGGGTAGG + Intronic
975035417 4:69674364-69674386 CAGGGGCACCAAAGGTGAAAAGG + Intergenic
976305737 4:83557753-83557775 GAGGGTCACTAACTGAGAGTTGG + Intronic
978103327 4:104870763-104870785 CAGGGTCTGCAACGGAGAGAGGG + Intergenic
978665293 4:111174789-111174811 CAGGTTCTCAAAAGAAGAGTAGG - Intergenic
978759360 4:112338878-112338900 CATGGTCACCTCAGGAGAGCAGG + Intronic
983952139 4:173654688-173654710 CACTGTCCACAAAGGAGAGTCGG - Intergenic
984478405 4:180266290-180266312 CAGAGTCCCTAAAGGAGAGGAGG + Intergenic
985353771 4:189095745-189095767 CCAGGTCACCGAAGGAGAATGGG + Intergenic
985405896 4:189637996-189638018 CAGGGAAGCCAAATGAGAGTGGG - Intergenic
985744337 5:1637804-1637826 TAGGCTCACCCAAGGACAGTTGG - Intergenic
986263443 5:6169553-6169575 AATGGAAACCAAAGGAGAGTAGG + Intergenic
986634233 5:9804060-9804082 AATGGACACCAAAAGAGAGTAGG + Intergenic
988379653 5:30483659-30483681 GAGGGTGACCTATGGAGAGTAGG - Intergenic
989219597 5:38942102-38942124 AAGGCTCAACAAAGGAGAGAAGG + Exonic
989730520 5:44642072-44642094 GAGGGGGGCCAAAGGAGAGTAGG + Intergenic
990667909 5:58094517-58094539 CATGGCCTCCAAGGGAGAGTGGG - Intergenic
990986820 5:61648467-61648489 CAGAGTGAACAAAGGAAAGTAGG + Intronic
993353811 5:86881581-86881603 CAGGGTGACCAAAGGACATGAGG - Intergenic
993568106 5:89500763-89500785 CAGGTTAATTAAAGGAGAGTAGG + Intergenic
998156039 5:139787809-139787831 CTGGGTCACCATGGGATAGTTGG + Intergenic
1000223247 5:159234257-159234279 CTGTGTCTCAAAAGGAGAGTAGG + Intergenic
1001132076 5:169072675-169072697 CAGGGTCAGCATAGAACAGTAGG + Intronic
1001408731 5:171495368-171495390 AAGGGCCACCAAGGGAGAGCGGG + Intergenic
1001447246 5:171794999-171795021 CAGAGTCCCCACAGGTGAGTGGG + Intergenic
1004346135 6:14850852-14850874 CAGCGACACCAAGGGAAAGTGGG - Intergenic
1004814093 6:19293886-19293908 CAGGGTGACCTGAGGAAAGTGGG - Intergenic
1010439412 6:75875996-75876018 CAGGGTGACTGAAGGAGAGAAGG - Intronic
1010658788 6:78544486-78544508 CTGGGTCATAAATGGAGAGTGGG + Intergenic
1012027763 6:94019681-94019703 CAGAGCCACCAAAGTAGAGATGG - Intergenic
1012956535 6:105576737-105576759 TATGGTCATTAAAGGAGAGTGGG - Intergenic
1013296360 6:108761470-108761492 CAGGTACAACAAAGGAGAGGGGG - Intergenic
1015184199 6:130394784-130394806 CAGGGTAAACAGAGGATAGTGGG + Intronic
1015825064 6:137302532-137302554 CAGCTTCACCAAAGGAGCATGGG - Intergenic
1016860372 6:148711979-148712001 CAGAGTCACCAATTGAGGGTGGG - Intergenic
1018710606 6:166495831-166495853 CAGGGTCAGCAAAGGCCACTGGG + Intronic
1019990865 7:4689854-4689876 CTGGGTCACCTAAGGGGACTGGG - Intronic
1020195434 7:6034466-6034488 AAGGGTCCCCTAAGGAGAATGGG - Intronic
1022657189 7:32330432-32330454 CAGACTCTCCAAAGGAGACTGGG + Intergenic
1025095428 7:56092251-56092273 CAGGGTCACCACATGGGAGTAGG + Intronic
1025192544 7:56907050-56907072 CATTGTCACCAAAGGAGAAAGGG + Intergenic
1025679402 7:63669872-63669894 CATTGTCACCAAAGGAGAAAGGG - Intergenic
1026595074 7:71727518-71727540 AAGGGTCACCTAAGAACAGTGGG - Intergenic
1028861082 7:95651337-95651359 CAGGGTCTCCAAAGCACTGTTGG - Intergenic
1030776521 7:113539778-113539800 CATGGTAACCAAAAGAGAGAAGG + Intergenic
1034544262 7:151779529-151779551 AAGGGTGCCCAAAGGAGTGTAGG - Intronic
1038158230 8:25011322-25011344 CAGGGTCTCCAAAGTTTAGTAGG + Intergenic
1040771495 8:50982927-50982949 CAAGGTAACCACAGGACAGTAGG - Intergenic
1042020406 8:64368393-64368415 CAGGGTGCCCAGAGCAGAGTTGG + Intergenic
1042577104 8:70232639-70232661 CAGGGTCTCCCAAGGTGAGGAGG - Intronic
1043105211 8:76100943-76100965 CAGGATTAGAAAAGGAGAGTAGG - Intergenic
1043800467 8:84603487-84603509 AAGAGTCAGAAAAGGAGAGTGGG + Intronic
1045543821 8:103110816-103110838 CAGGGCCACCAGAGTAGAGTGGG - Intergenic
1047194601 8:122710126-122710148 CAGAGTCAGAAAAGGAGATTGGG - Intergenic
1048290719 8:133179506-133179528 TGGGGTCTCCAAAGGTGAGTTGG + Intergenic
1049162002 8:141103693-141103715 CTAGGTCTCCAAAGGGGAGTTGG - Intergenic
1049457854 8:142702949-142702971 CTGGGGCACCAAGGGGGAGTCGG - Intronic
1049462494 8:142736578-142736600 CAGAGTCACCAAGGCAAAGTTGG + Exonic
1049822824 8:144646502-144646524 CAGGGACACCAAAAGACAGGAGG + Intergenic
1051470991 9:17441867-17441889 AAGGGTAAGCAAAGGAGAGAAGG + Intronic
1051891024 9:21943139-21943161 CAGTGTTCTCAAAGGAGAGTTGG + Intronic
1055554335 9:77460007-77460029 CAGGGAGACCAAAGCAGAGAGGG - Intronic
1055900104 9:81224409-81224431 CAGGGTCTTCAAACCAGAGTTGG + Intergenic
1056812413 9:89775013-89775035 CAGGGTGACCAGAAGAGAATCGG - Intergenic
1056936390 9:90918238-90918260 CACGGTTGTCAAAGGAGAGTAGG + Intergenic
1056952226 9:91050313-91050335 CATGGAAACCAAAAGAGAGTGGG + Intergenic
1058811740 9:108646198-108646220 GAGGGTCATCAAAGGCAAGTGGG + Intergenic
1060818424 9:126647971-126647993 CAGGGTCAGGAGAGCAGAGTGGG - Intronic
1203656978 Un_KI270753v1:7418-7440 CAGGGAAGCTAAAGGAGAGTGGG - Intergenic
1190427231 X:50345161-50345183 GAGGGGCAACAAAGGAGAGTGGG - Intronic
1190581585 X:51896283-51896305 CAGGGTGACCAATGGCTAGTGGG + Intronic
1190643635 X:52504594-52504616 CAGGGTCACCCAGTGAGACTTGG - Intergenic
1192109680 X:68351531-68351553 CATGGTCACCAAAGCACAGCTGG + Intronic
1193421018 X:81282001-81282023 TATGGACACCAAATGAGAGTGGG + Intronic
1196590297 X:117479648-117479670 AAGGGACACCAAAAGAGAGCAGG - Intergenic
1196981437 X:121218171-121218193 CAGGTTCTCCAAAGCAGAGTTGG - Intergenic
1198310632 X:135424097-135424119 CTGGGGCACCAAGGGAGAGAGGG + Intergenic
1198401368 X:136271466-136271488 GAGGGTCATCAAAGGAGAAAAGG + Intergenic
1199478358 X:148271092-148271114 CACCGCCACTAAAGGAGAGTTGG - Intergenic
1199739027 X:150715150-150715172 CAGGGTCACCAAAGGAGAGTGGG - Intronic