ID: 1199742287

View in Genome Browser
Species Human (GRCh38)
Location X:150746906-150746928
Sequence CAGGTATAAGATGCAGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199742285_1199742287 25 Left 1199742285 X:150746858-150746880 CCATGACTAGTCTTTATCAGTTC 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1199742287 X:150746906-150746928 CAGGTATAAGATGCAGTCATAGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199742287 Original CRISPR CAGGTATAAGATGCAGTCAT AGG Intronic
900232312 1:1566192-1566214 CAGGCACAAGTTGCAGACATTGG + Intronic
901326278 1:8367357-8367379 CAGGCATAAGATGCAGCTGTGGG - Intronic
901947727 1:12717271-12717293 CTTTTATAAGATGCAGTGATTGG + Intronic
904374999 1:30075208-30075230 CAGGTTGAAGATGGAATCATAGG - Intergenic
906955726 1:50372094-50372116 CAGATGTGAGATGGAGTCATAGG - Intergenic
908909944 1:69061764-69061786 CAGGTAGGAGATGAAATCATAGG - Intergenic
911767790 1:101700316-101700338 TATGTATAAGATGCAATCATAGG + Intergenic
912409346 1:109468841-109468863 CAGGGAAATGATGCAGTCTTGGG + Intronic
912581928 1:110728789-110728811 CAGGTCAAAGATGAAATCATAGG + Intergenic
915205813 1:154269679-154269701 CAGGTATGAGAGGCAGTCTGAGG - Intronic
919259414 1:195172400-195172422 CAGGCACAAGTTGCAGTAATAGG - Intergenic
919881069 1:201900926-201900948 CAGGTTTAAGCTGCAGAAATGGG + Intronic
921105639 1:211974821-211974843 CAGGTATGAGATGAGGTCAGGGG + Intronic
921742050 1:218696428-218696450 TAGGAATAAGAGGCAGTCTTTGG + Intergenic
922517440 1:226218819-226218841 CAGGTATAAAATGAAGTAACGGG + Intergenic
922776515 1:228216575-228216597 CAAGTATGAGGTGCAGGCATCGG + Exonic
923830245 1:237547728-237547750 CAGGTATAAGTTGTAATCGTTGG - Intronic
1063327774 10:5122200-5122222 CAGGTAGAAGCTGCTGTCCTGGG - Intronic
1065089883 10:22220885-22220907 CAGGTAATAAATGCAGTCCTGGG + Intergenic
1069831420 10:71284492-71284514 CAGGTAGAAGATGCATTGGTGGG + Intronic
1069952354 10:72027839-72027861 CATCTATAAAATGCAGTCAAGGG + Intergenic
1070639184 10:78154185-78154207 CAGGTAAAAAATGGAGTCCTGGG - Intergenic
1071424301 10:85532992-85533014 CAGGTAGGAGATGAAATCATAGG - Intergenic
1079222596 11:18576770-18576792 TAGGTAGAAGATGAAATCATGGG - Intronic
1083719640 11:64598021-64598043 CAGGAGGAAGATGCAGCCATGGG + Intronic
1085494629 11:76957185-76957207 CAAAGATAAGATCCAGTCATTGG - Intronic
1086138067 11:83462639-83462661 GGGGTATAAAATGCAGTTATAGG + Intronic
1088645576 11:111913756-111913778 CAGGTTTAAGATGCCATCATGGG - Exonic
1089833130 11:121346610-121346632 CAGGTTGGAGATGGAGTCATAGG - Intergenic
1089986470 11:122818872-122818894 CAGGTAGAAGATGAAATCATAGG - Intergenic
1090248335 11:125233748-125233770 CAGTTAGAAGATTCAGGCATGGG - Intronic
1090925900 11:131250205-131250227 CAGGTCTAACAGCCAGTCATGGG + Intergenic
1093101047 12:15029755-15029777 CAGGTTGAAGGTGGAGTCATAGG + Intergenic
1093848255 12:24001807-24001829 CAGACATAAGATGCAGGTATGGG + Intergenic
1095360812 12:41336758-41336780 CAGGTTGAAGATGGAATCATGGG + Intronic
1095479803 12:42623154-42623176 CAGGTTGAAGATGGAATCATGGG - Intergenic
1095642849 12:44504636-44504658 CATGTAGAAGATGCTGTCAGAGG - Intergenic
1095898195 12:47301599-47301621 CAGGTTGAAGATGGAATCATGGG + Intergenic
1098178328 12:67817788-67817810 CTGGGATAAGGTGCAGTCAGTGG - Intergenic
1099120366 12:78682149-78682171 CAGTTATAAGGTACAGTCATCGG + Intergenic
1099812338 12:87599671-87599693 CAGGAACAAGCTGCAGTGATAGG + Intergenic
1099935467 12:89119719-89119741 TAGGTATAAGATGCAAAGATGGG - Intergenic
1101880036 12:108619996-108620018 CAGGTTGGAGATACAGTCATAGG - Intergenic
1106590535 13:31094729-31094751 CAGGTTGAAGATGAAATCATAGG + Intergenic
1108210793 13:48137966-48137988 CAGGTATCACATGCAGTGCTAGG - Intergenic
1108805294 13:54147747-54147769 CAGGTCAAAGATGAAATCATAGG + Intergenic
1110359288 13:74607192-74607214 CAGGTATCAGTTGGACTCATAGG + Intergenic
1110684687 13:78358253-78358275 CAGGTAGCAGATGCTGACATAGG + Intergenic
1112898676 13:104333554-104333576 CAGGTATAAGATAAAAGCATTGG + Intergenic
1117106033 14:52397853-52397875 CAGTTGTAAGATTCAGGCATTGG + Intergenic
1117632474 14:57708265-57708287 CAGGTTTGAGATGGAATCATAGG - Intronic
1120030570 14:79636244-79636266 CAGTTATAACATGGAGTTATGGG - Intronic
1120268066 14:82276408-82276430 CAGGTCAGAGATGAAGTCATAGG + Intergenic
1120357600 14:83454500-83454522 TAGGTAGAAGATGAAATCATAGG - Intergenic
1121421015 14:93814320-93814342 CTGGTTGAAGATGCAATCATAGG + Intergenic
1123966877 15:25468187-25468209 AAGATATAAGGTTCAGTCATTGG + Intergenic
1125360507 15:38859834-38859856 CAGGTATAAGATGGGGTCAGTGG - Intergenic
1127647080 15:60969652-60969674 GAGGGATAGGATGCTGTCATCGG - Intronic
1132380279 15:101361482-101361504 CAGGTCTGAGCTGCAGCCATGGG + Intronic
1134487266 16:14668278-14668300 CAAGGATAAGATTCTGTCATAGG + Exonic
1136164856 16:28446695-28446717 CAGGTATAAGAGCCAGGCACAGG + Intergenic
1136198110 16:28668286-28668308 CAGGTATAAGAGCCAGGCACAGG - Intergenic
1136214456 16:28782462-28782484 CAGGTATAAGAGCCAGGCACAGG - Intergenic
1136259178 16:29062306-29062328 CAGGTATAAGAGCCAGGCACAGG - Intergenic
1138295186 16:55879454-55879476 CAGTGATAGGGTGCAGTCATGGG - Intronic
1140642485 16:76992684-76992706 AAAATAAAAGATGCAGTCATAGG + Intergenic
1143456727 17:7072685-7072707 CAGGTATGAGCTGCAGTGCTTGG - Intergenic
1144183668 17:12775663-12775685 CAGTTATAAGAAGTAGGCATTGG + Intergenic
1146415774 17:32631336-32631358 CAGGTTTAAAAGGCAGTCTTTGG + Intronic
1146722867 17:35135398-35135420 CAGGAATAAGGTGAAGTCGTCGG + Exonic
1147201193 17:38802680-38802702 CAGGAAGAAGATGCACTCACTGG + Exonic
1149477287 17:56973790-56973812 CAGGTTGAAGATGAACTCATAGG + Intergenic
1151751116 17:76038384-76038406 CAGGTTGGAGATGAAGTCATAGG - Intergenic
1153159853 18:2191795-2191817 AAGGTATAAGATGGTGTCATAGG + Intergenic
1154020528 18:10660651-10660673 ATGGTGTGAGATGCAGTCATCGG + Intergenic
1157292938 18:46422915-46422937 CAGGTAATAGCTGCAGTCAAAGG - Intronic
1158789001 18:60751951-60751973 CAGTTATAAAATGCACTAATGGG + Intergenic
1165989001 19:39795290-39795312 CAGGTAGAAGTTGCAGAGATGGG - Intergenic
1166435101 19:42761028-42761050 CAGGTTGAGGATGGAGTCATGGG + Intronic
929120347 2:38479038-38479060 CAGGTTGAAGATGGAATCATAGG - Intergenic
930032155 2:47064939-47064961 CATGTATAAAATGTATTCATGGG + Intronic
930302780 2:49638216-49638238 CAGGTTTGAGATGGAATCATCGG - Intergenic
930612335 2:53556758-53556780 AATGTATATTATGCAGTCATTGG - Intronic
931256611 2:60579753-60579775 CAGGTATTAGATGTAATCAAAGG + Intergenic
932663132 2:73674209-73674231 CTGGTTTAAGATGCAGTGACAGG - Intergenic
933001735 2:76933313-76933335 CAGTTTTAAGATGTAGTGATTGG - Intronic
933570055 2:83999952-83999974 CATGTATAAGATGTAGTATTCGG - Intergenic
936049595 2:109213040-109213062 CAGGTGGAGGATGCAGTCCTGGG + Intronic
937184832 2:120030486-120030508 CAGGTTGAAGATGGAATCATAGG - Intronic
938483340 2:131680018-131680040 CAGGTAGAAGATGCGGCAATGGG + Intergenic
940362892 2:152814686-152814708 CAGGTAGAAGATGAAATCATAGG - Intergenic
941028867 2:160489390-160489412 CAGGCATAATATTCAGACATGGG - Intronic
943541304 2:189218155-189218177 CAGATATAAGTTGCTGTTATAGG + Intergenic
946588155 2:221213936-221213958 CAGGTATATGTTGATGTCATAGG + Intergenic
1169635214 20:7683157-7683179 CAGGTTGAAGATGAAATCATAGG - Intergenic
1172899470 20:38323940-38323962 CAGGTATACCATGCGGTCATGGG - Exonic
1173632603 20:44528037-44528059 CAGGTAGGAGATGAAATCATGGG - Intergenic
1174944312 20:54968081-54968103 CATGAATAAGATGCAGCAATTGG - Intergenic
1175627553 20:60501394-60501416 CAGGGATAGGATGAAGTTATGGG + Intergenic
1178584824 21:33863162-33863184 CACCTATTAGATTCAGTCATGGG - Intronic
1179116022 21:38493625-38493647 CAGGAGCACGATGCAGTCATAGG + Intronic
1182335697 22:29581927-29581949 CAGGTCGGAGATGCAATCATAGG + Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
951781856 3:26372404-26372426 CAGGTATAAAAAACATTCATTGG - Intergenic
952599288 3:35059785-35059807 CATTTACAAGATGGAGTCATGGG + Intergenic
954826864 3:53381191-53381213 ATGGTATAGGATGTAGTCATTGG - Intergenic
955619869 3:60851323-60851345 CAAGGATCAGATGAAGTCATTGG + Intronic
957013197 3:75031459-75031481 CAGTTATATAATGGAGTCATAGG + Intergenic
959330715 3:105001221-105001243 TAGGTATAAGATCATGTCATCGG - Intergenic
966499537 3:180623891-180623913 AAGGTATATTATGCAGTCGTTGG + Intronic
968491770 4:893986-894008 CAGGTACAAGATGCAGCCCAGGG + Exonic
968849246 4:3067451-3067473 CAGGCATAAGATGCATTTAATGG + Intergenic
970440046 4:16072942-16072964 CGGGTAGAAGATGAAATCATAGG - Intronic
970537860 4:17047853-17047875 CAGATATAAGTAGCAGACATGGG - Intergenic
973702393 4:53550298-53550320 CAGGAACAAGATCCAGTCTTGGG - Intronic
974383781 4:61177947-61177969 CAGGTAAAGGATTCAGTGATTGG - Intergenic
978312145 4:107396494-107396516 CAAGTAAAAGATGCACTCAAGGG + Intergenic
980270439 4:130577098-130577120 CAGGTAGGAGATGAAATCATAGG - Intergenic
982354138 4:154448257-154448279 TAGATATAAAATGAAGTCATAGG - Intronic
982675713 4:158373603-158373625 CAATTCTAAGATGCAGGCATTGG - Intronic
985300638 4:188485287-188485309 AAGGTATAAGAAGGAGTCAGAGG + Intergenic
985300722 4:188486191-188486213 CAAGTACAACATACAGTCATAGG - Intergenic
986362561 5:6994489-6994511 GTGGTAGAAGATGCAGTCCTAGG - Intergenic
989652777 5:43711915-43711937 CAAATATAAGTTGTAGTCATAGG - Intergenic
990227457 5:53671385-53671407 CAGGGAGAAAATGAAGTCATAGG - Intronic
990327911 5:54696333-54696355 CAGGTGAAGCATGCAGTCATGGG - Intergenic
993805463 5:92402865-92402887 CAGGTAACAGATGTAGCCATGGG - Intergenic
994680912 5:102886711-102886733 GATGAGTAAGATGCAGTCATTGG - Intronic
997541239 5:134664755-134664777 CAGTTGTAAGATTCAGTAATAGG + Intronic
997657212 5:135564239-135564261 CAGACCTAAGATGCAGCCATGGG - Intergenic
999556950 5:152753470-152753492 CAGGTATAACAGTCAATCATAGG - Intergenic
1004384736 6:15162982-15163004 CAGTTATAAGATGCTCTTATTGG + Intergenic
1004664831 6:17740441-17740463 CAGTTATAAAATGCAGTCCTTGG - Intergenic
1007277057 6:40682209-40682231 CAGGTAGAAGATGCCGTCTGTGG - Intergenic
1009813696 6:68703035-68703057 CAGATATAAGATGCATTGATGGG + Intronic
1009992166 6:70856971-70856993 CAGAGATAAGATGGAGTCTTTGG - Exonic
1010017977 6:71126534-71126556 CAGAGATAAGAAGCAGACATAGG - Intergenic
1011338696 6:86287998-86288020 CAGGTTGAAGATGAAATCATAGG - Intergenic
1011411995 6:87075508-87075530 CAGGTATAAAGTGCAGAGATGGG - Intergenic
1014180207 6:118376178-118376200 CTAATATAAGATGAAGTCATTGG - Intergenic
1014232000 6:118914328-118914350 CAGGTATTTCATTCAGTCATTGG + Intronic
1016581907 6:145637625-145637647 CAGGGATAAGATGAAGGCCTTGG - Intronic
1018136003 6:160778981-160779003 CATGGATCAGATACAGTCATGGG - Intergenic
1021245841 7:18260172-18260194 CAGGTTTAAAAGGCAGCCATTGG - Intronic
1023408494 7:39862814-39862836 TAGGTATAAGATCGTGTCATTGG + Intergenic
1024134032 7:46388659-46388681 CAGGTCAAAGATGAAATCATAGG - Intergenic
1025137376 7:56429729-56429751 TAGGTATAAGATCGTGTCATTGG - Intergenic
1031781083 7:125966312-125966334 TATGTATAAGATACAGTCATTGG - Intergenic
1034577116 7:152009850-152009872 CAGGTATTAGTTACAGCCATGGG - Intronic
1037658353 8:20906518-20906540 CAGTTATTAGATGCAGGCATTGG + Intergenic
1042391709 8:68243450-68243472 AAGCTATAAGATGCTGTCAGTGG + Intergenic
1044714380 8:95087278-95087300 AATGTATAAGAAGCAGTCAGTGG - Intronic
1045862255 8:106826760-106826782 TAGGGGTAAGATGCAGGCATTGG - Intergenic
1049331274 8:142055248-142055270 CAGTAAGAAGCTGCAGTCATTGG + Intergenic
1049763155 8:144339832-144339854 CAGGTATGGGATGCAGTTACTGG + Intergenic
1050930429 9:11316301-11316323 CAGGTTTAAAATGCATTCAGAGG + Intergenic
1052074015 9:24118356-24118378 CAGGTCAGAGATGAAGTCATAGG + Intergenic
1056221018 9:84450851-84450873 CAGGTAGGAGATGAAATCATAGG - Intergenic
1056481191 9:87008030-87008052 CAGGAATGAGATGCAATTATGGG - Intergenic
1056863088 9:90205219-90205241 CAGGTCTAAGATTCTGTCTTGGG + Intergenic
1059253313 9:112906604-112906626 CAGGTTGAAGATGGACTCATGGG - Intergenic
1060035057 9:120248163-120248185 CAAGTAAAAGAAGCAGACATTGG + Intergenic
1061551542 9:131337597-131337619 CCGGGTTAAGATGCGGTCATCGG + Intergenic
1186083637 X:5961988-5962010 CAGGTATAAGATGCCATGAAGGG - Intronic
1188307706 X:28578758-28578780 CAGGTATAAGATGCCTCCAGTGG + Intergenic
1188871736 X:35381799-35381821 CAGGTTGAAGATGGAATCATAGG + Intergenic
1193115527 X:77771882-77771904 CAGGGATAAAATGCATTCACAGG + Intronic
1198129371 X:133678452-133678474 TAGGGAAAAGATGCAGTCGTGGG - Intronic
1199360240 X:146908639-146908661 TGGGTAGAAGATGCAGTGATTGG + Intergenic
1199528346 X:148818644-148818666 CAGGGATAAGAAGCAGTCAGGGG + Intronic
1199742287 X:150746906-150746928 CAGGTATAAGATGCAGTCATAGG + Intronic
1201511204 Y:14765513-14765535 CAGGTATAAGATGCCATAAAGGG + Intronic