ID: 1199742685

View in Genome Browser
Species Human (GRCh38)
Location X:150750549-150750571
Sequence CTCAGCCAGATCTATAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199742685 Original CRISPR CTCAGCCAGATCTATAAGTT TGG Intronic
900833458 1:4981583-4981605 CTCTGCCTGATCTATAGTTTAGG + Intergenic
903009614 1:20320430-20320452 CTCAGCCAGATGAGTCAGTTGGG + Intronic
903684668 1:25122046-25122068 CTGAGTCAGAGCTATCAGTTTGG + Intergenic
904137420 1:28324361-28324383 GTCAGACAGATCTATAATTCTGG - Intergenic
904389723 1:30174280-30174302 ATCAGCCAGTTCTCTAAGTCAGG + Intergenic
915692227 1:157701041-157701063 CTCACCCAGATCTGCAAATTAGG + Intergenic
917924135 1:179774807-179774829 CTCAGCCAGAACTAAAAATGAGG - Intronic
1065614047 10:27501951-27501973 CTCAGCCAGAGATGTAAATTCGG + Intergenic
1068643353 10:59436466-59436488 CCCAGTCAGATTTATCAGTTAGG + Intergenic
1070691420 10:78529773-78529795 CTGAGCCACATCTATAAATGGGG - Intergenic
1073072948 10:100806240-100806262 CTCAGCCAGATCTCTGAGGCAGG + Intronic
1075934447 10:126327404-126327426 GTAAGCCAGATCTGGAAGTTTGG - Intronic
1076102015 10:127790035-127790057 CTTAGCCATTTCTATAAGCTAGG + Intergenic
1079736543 11:24004156-24004178 TTCAGCCAGATATATATATTTGG + Intergenic
1080878444 11:36297733-36297755 ATCAGCCAGATCTTTGAATTTGG + Intronic
1099495686 12:83343299-83343321 CTGAGCCACAGCTATAAGTGGGG - Intergenic
1099997435 12:89794604-89794626 CTCAATAAGATCTATAAATTAGG - Intergenic
1101006017 12:100401363-100401385 CTCATCCAGATCTTTAAATGAGG - Intronic
1103183821 12:118938573-118938595 GTCTGCCAGATGTATAAATTAGG - Intergenic
1107315869 13:39131142-39131164 TTTAGCCAGATCTATAAGGTTGG + Intergenic
1108116440 13:47133962-47133984 CTCAGCCAGATCCCCAAGTGTGG + Intergenic
1108774626 13:53750651-53750673 CTCAGACAGATGTTTAAGCTAGG + Intergenic
1110771426 13:79352291-79352313 CTGAGCCAGAACTAGAATTTGGG - Intronic
1111291513 13:86177147-86177169 TTCAGCCAAATATATAAGGTTGG + Intergenic
1114064317 14:19048030-19048052 CTCAGCCAGCACTAAAAGTTGGG + Intergenic
1114097942 14:19351968-19351990 CTCAGCCAGCACTAAAAGTTGGG - Intergenic
1126329431 15:47515940-47515962 CACAGCCAAAGCTATAATTTGGG + Intronic
1128923374 15:71632063-71632085 TTCTGCCAGCTCTATAAGATAGG - Intronic
1131274182 15:90966981-90967003 CTCATTCACATCTTTAAGTTAGG + Exonic
1140790407 16:78385904-78385926 CGCACCCAGATTTAAAAGTTGGG + Intronic
1140830017 16:78742357-78742379 CTGAGCCAGAGCTAGAAGTGGGG - Intronic
1147751700 17:42739235-42739257 CACAGCCTGATCTCTCAGTTAGG + Intronic
1149899696 17:60463146-60463168 CTCTCTCAGATCTATAATTTTGG + Intronic
1151104596 17:71597759-71597781 CGGAGCCAGACATATAAGTTTGG + Intergenic
1154947917 18:21180698-21180720 CTGAGCCAGATCTCTAGATTTGG - Intergenic
1155710840 18:28877235-28877257 CTCATGCAGATCTCTAAGTGAGG + Intergenic
1161653520 19:5499116-5499138 CTCAGCCAGATCCAGAAGGTGGG + Intergenic
1163564244 19:18040480-18040502 TCCAGCCAGTTCTGTAAGTTGGG - Intergenic
1167772612 19:51530602-51530624 CTGAGCCAGAGCTTAAAGTTGGG - Intronic
929912463 2:46101796-46101818 CACAGACAGAACCATAAGTTGGG + Intronic
935059765 2:99597079-99597101 CTGAGCCTCATCTACAAGTTAGG - Intronic
941050008 2:160722126-160722148 CTCAGAGAGATGAATAAGTTAGG - Intergenic
1169487872 20:6048397-6048419 CTGAGCCAGAGGTATAAATTTGG - Intronic
1174550807 20:51360217-51360239 CCCAGCCTCATCTATAACTTGGG - Intergenic
1176426300 21:6550659-6550681 CTCAGCCAGATCCAACAATTAGG - Intergenic
1178076573 21:29018406-29018428 CTCAGCTAGATATATAATCTTGG + Intronic
1178237806 21:30863449-30863471 ACCAGCCAGATCTAGAATTTTGG + Intergenic
1179055314 21:37926480-37926502 CTTAGCCAGATCCATACGTTCGG - Intergenic
1179701791 21:43158976-43158998 CTCAGCCAGATCCAACAATTAGG - Intergenic
1180482808 22:15770656-15770678 CTCAGCCAGCACTAAAAGTTGGG + Intergenic
1183360512 22:37380715-37380737 CCCAGCCAGATCTCTCAGGTAGG + Intronic
952631282 3:35471182-35471204 CTAAGGCAGATCTATCATTTTGG - Intergenic
954725982 3:52611018-52611040 CTCAGCCATATGTTTAAGTCTGG + Intronic
959188356 3:103076789-103076811 CTAAGCCACATCTATAAGCATGG + Intergenic
962673014 3:137728190-137728212 CTCATCATGATCTATAAATTGGG - Intergenic
962769213 3:138596509-138596531 CTGAGTCAGATTTATAAGTGGGG + Intergenic
966361734 3:179137352-179137374 CTCAGCCCTATATATAGGTTTGG - Intergenic
970813103 4:20119024-20119046 CTCAGCTATAACTATTAGTTAGG - Intergenic
976686826 4:87823016-87823038 CTCTTCCAGATCTCAAAGTTTGG + Intronic
979106255 4:116691629-116691651 CTGAGACAGATCAATAAGTTTGG + Intergenic
982781849 4:159499613-159499635 ATCATCCAGATCTATAAATGAGG + Intergenic
985007158 4:185545318-185545340 CTCAGATAGTTCTGTAAGTTAGG + Intergenic
987648674 5:20711099-20711121 ATCTTACAGATCTATAAGTTAGG + Intergenic
988747659 5:34157828-34157850 GTCTTACAGATCTATAAGTTAGG - Intergenic
990027676 5:51215005-51215027 CTGAGTGAGATCTATATGTTAGG - Intergenic
992398100 5:76386296-76386318 ACCAGACAGCTCTATAAGTTTGG + Intergenic
998727730 5:145037109-145037131 CTGAGCCAGAAGTATAATTTTGG - Intergenic
999283518 5:150380292-150380314 CTCCACCAGCTCTATAAGCTAGG + Intronic
1004093910 6:12533780-12533802 CTCAGACAGATCTGCAAGATTGG - Intergenic
1005545156 6:26860184-26860206 GTCTTACAGATCTATAAGTTAGG - Intergenic
1008853534 6:56053517-56053539 ATAGGCCAGATCTATAATTTAGG + Intergenic
1009015948 6:57901806-57901828 ATCTTACAGATCTATAAGTTAGG - Intergenic
1010418420 6:75642880-75642902 CTCAGCAAGGTCTAGGAGTTGGG + Intronic
1012127326 6:95447002-95447024 CTCACCCTGATCTATGAGGTAGG + Intergenic
1015312645 6:131782309-131782331 GTCAGCCAGACCAATAAGTAGGG + Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1021200678 7:17725854-17725876 CTCAGCTAGATAAATTAGTTGGG - Intergenic
1024413062 7:49069475-49069497 CTCAGCCTGCTCTATATGTGAGG + Intergenic
1027683101 7:81245169-81245191 CTCAGCCATAACTAATAGTTAGG + Intergenic
1033598529 7:142872995-142873017 TTCAGCCAGATCTTCAAGATAGG - Intronic
1039532136 8:38272278-38272300 CTCAGCCAGTTCTATAGATGAGG + Exonic
1041138620 8:54789342-54789364 CTCAGGCAGGGCTGTAAGTTAGG - Intergenic
1056334813 9:85557313-85557335 ATCATCCAGATAAATAAGTTTGG - Intronic
1058637807 9:107053608-107053630 CTCAGCCAGTTCTACATTTTAGG + Intergenic
1187328477 X:18314049-18314071 CTCAGCTAAATTTATAATTTTGG - Intronic
1188038450 X:25344237-25344259 CTCAGCCACATCTCTAATATAGG - Intergenic
1188141884 X:26560516-26560538 ATCAACTAGATCAATAAGTTTGG + Intergenic
1189376229 X:40468259-40468281 CTAAGCCTGGTCTATAAGATTGG - Intergenic
1193021183 X:76795562-76795584 CTCAGCCAGGACAATCAGTTGGG + Intergenic
1194523733 X:94950430-94950452 CTCATCCAAATCCATAAGTTAGG + Intergenic
1196392821 X:115226714-115226736 GTCACCCAGATCTAAAACTTGGG - Intronic
1197565303 X:128076972-128076994 CACAGACACATCTATAACTTTGG - Intergenic
1198150300 X:133901910-133901932 CACAGCCAGCTCTAGAAATTGGG - Intronic
1199742685 X:150750549-150750571 CTCAGCCAGATCTATAAGTTTGG + Intronic