ID: 1199745642

View in Genome Browser
Species Human (GRCh38)
Location X:150770617-150770639
Sequence GCCCTATGAGGATGGAGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 174}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199745642_1199745645 -1 Left 1199745642 X:150770617-150770639 CCGGCACTCCATCCTCATAGGGC 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1199745645 X:150770639-150770661 CAGCTGCCACCGCGTCAAGACGG 0: 1
1: 0
2: 0
3: 5
4: 169
1199745642_1199745652 21 Left 1199745642 X:150770617-150770639 CCGGCACTCCATCCTCATAGGGC 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1199745652 X:150770661-150770683 GCAGCTCCGCCCAGTGGAGGGGG 0: 1
1: 0
2: 0
3: 23
4: 253
1199745642_1199745651 20 Left 1199745642 X:150770617-150770639 CCGGCACTCCATCCTCATAGGGC 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1199745651 X:150770660-150770682 GGCAGCTCCGCCCAGTGGAGGGG 0: 1
1: 0
2: 2
3: 23
4: 227
1199745642_1199745648 15 Left 1199745642 X:150770617-150770639 CCGGCACTCCATCCTCATAGGGC 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1199745648 X:150770655-150770677 AAGACGGCAGCTCCGCCCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 85
1199745642_1199745649 18 Left 1199745642 X:150770617-150770639 CCGGCACTCCATCCTCATAGGGC 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1199745649 X:150770658-150770680 ACGGCAGCTCCGCCCAGTGGAGG 0: 1
1: 0
2: 1
3: 4
4: 86
1199745642_1199745650 19 Left 1199745642 X:150770617-150770639 CCGGCACTCCATCCTCATAGGGC 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1199745650 X:150770659-150770681 CGGCAGCTCCGCCCAGTGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199745642 Original CRISPR GCCCTATGAGGATGGAGTGC CGG (reversed) Intronic
900726931 1:4222666-4222688 GAGCTGTGACGATGGAGTGCAGG + Intergenic
900980417 1:6043167-6043189 GCTCTCTGAGGATGCAGTTCAGG - Intronic
901868012 1:12120242-12120264 GCTCTGCTAGGATGGAGTGCTGG - Intronic
902245827 1:15119867-15119889 ACCCCCTGAGGCTGGAGTGCTGG + Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903650458 1:24918717-24918739 ACCCTATGAGCAGGGAGTTCTGG - Intronic
906692202 1:47799883-47799905 TTGCTATGAGGATGGAGTGGAGG - Intronic
909539539 1:76775788-76775810 GCCCTGTGAGGATAGAATTCTGG - Intergenic
910141319 1:84030293-84030315 TCCCTGTGAGGTTGTAGTGCAGG - Intergenic
911994536 1:104748059-104748081 GCCATGTGAAGATGTAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914860800 1:151384310-151384332 ACCTTCTGAGGTTGGAGTGCTGG + Intergenic
915568663 1:156731874-156731896 GCCCTATGTGGCAGCAGTGCTGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
916874965 1:168959461-168959483 GCCATTTGAGGATGGATTTCTGG - Intergenic
918078865 1:181190609-181190631 ACCCTATGAGGAGGGAGGGGAGG - Intergenic
920098904 1:203504574-203504596 GCCCCAGTAGGATGGTGTGCAGG - Intronic
921358015 1:214304740-214304762 ACCCCATGAAGATGGAGTGTTGG - Intronic
922563347 1:226585299-226585321 GTCCTCTGAGGAGGCAGTGCTGG - Intronic
923476074 1:234332502-234332524 GTCCTATGTGGTTGGAGGGCAGG - Intergenic
1069554175 10:69386140-69386162 CCCCTATGAGGATGGTGAGGAGG + Intronic
1069618285 10:69820247-69820269 GCCCCATGAGGATGGAGCAGGGG + Intronic
1070230303 10:74558992-74559014 GACCTATGAGGCTTGAGTTCTGG - Intronic
1074093466 10:110285755-110285777 GGCCTATGAGTATGGATTGGGGG + Exonic
1077845765 11:6023049-6023071 GCCCTATGAGCAGGAAGTACAGG + Intergenic
1078086034 11:8233507-8233529 GCCCTATGAGGAAGGAAGGCTGG - Intronic
1078364110 11:10692688-10692710 GCTCTGGGAGGCTGGAGTGCTGG + Intronic
1079251872 11:18792615-18792637 CCCCCATGGGGATGGAATGCCGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1085336532 11:75701006-75701028 GCCCTGTGATGTTGGAGTGCTGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1089372293 11:117969930-117969952 GCCTTAGGAGGATGCAGGGCAGG + Intergenic
1089745349 11:120613043-120613065 GCCATTTGAGGCTGGAGGGCTGG + Intronic
1092009666 12:5098919-5098941 GCTTTATGAGCCTGGAGTGCTGG + Intergenic
1092524824 12:9303360-9303382 GCCCTGTGAGAACGCAGTGCTGG + Intergenic
1092542442 12:9428459-9428481 GCCCTGTGAGAACGCAGTGCTGG - Intergenic
1094510572 12:31093978-31094000 GCCCTGTGAGAACGCAGTGCTGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097250598 12:57630516-57630538 GCCCTAGGAGAAAGGAGTGGGGG + Exonic
1098190760 12:67945934-67945956 GCCCTGTGAGGATGGTATGTGGG - Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1098977631 12:76919841-76919863 GCCCTTTGTGGATGGGCTGCTGG + Intergenic
1099993658 12:89753404-89753426 GGCCTATGTGGTTGGAGTTCAGG - Intergenic
1103340051 12:120216359-120216381 GCCCCATGATGAGGGGGTGCAGG - Intronic
1104174323 12:126315062-126315084 GCCCTAGCTGGAAGGAGTGCTGG - Intergenic
1104371423 12:128227208-128227230 GCAATATCAGGATGGATTGCCGG + Intergenic
1105601495 13:21892294-21892316 GCCTGATGAGGAAGGAGTGAGGG - Intergenic
1107333237 13:39324516-39324538 GCCCTGTGTGGACGGAGTGAGGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1113864081 13:113509541-113509563 GCCCTAGAAGGAAGGGGTGCAGG - Intronic
1117344238 14:54817327-54817349 TCCCTGTGAGGATGGTGTGTGGG + Intergenic
1119383975 14:74245783-74245805 GCCTTAGGTGGATGGAGTGGTGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121224566 14:92311878-92311900 GCCCTATGGGGATGGGCTGTTGG + Intergenic
1129609589 15:77042657-77042679 GGCAAATGAGGAAGGAGTGCTGG + Exonic
1129974150 15:79807378-79807400 GCCCTTTGAAGATGGAGTAAGGG - Intergenic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1131816689 15:96228586-96228608 GCCCTTTGTGTATGGAGTGTTGG + Intergenic
1132753800 16:1472047-1472069 GCCCTGTGCGGATGGTCTGCAGG - Intronic
1133039456 16:3052641-3052663 GCCCTTGGAGGATGGCGTCCTGG + Intronic
1133043299 16:3072274-3072296 GCCCTTGGAGGATGGTGTCCTGG + Intronic
1133518614 16:6534381-6534403 GGCCTATGGGGATGGAATTCAGG + Intronic
1135170543 16:20179491-20179513 GTCCTATGTGGATGGAGGACAGG + Intergenic
1135949710 16:26902695-26902717 GATCTTTTAGGATGGAGTGCTGG - Intergenic
1136454941 16:30375099-30375121 GCCTTAGGAAGATGGAGTACAGG - Intronic
1137935222 16:52628662-52628684 CACCTTGGAGGATGGAGTGCTGG - Intergenic
1138352642 16:56354074-56354096 AACCAATGAGGAAGGAGTGCAGG + Intronic
1138696195 16:58815751-58815773 ACCCTGTGAGGATGGACAGCGGG + Intergenic
1139482472 16:67238090-67238112 GCTCTTTGTGGATGGAATGCTGG - Exonic
1139504402 16:67391878-67391900 GCCCTAGGCGCAGGGAGTGCTGG - Exonic
1140071574 16:71655080-71655102 TCTATATGAGCATGGAGTGCGGG - Intronic
1142390654 16:89797486-89797508 GCCCTGTGAGGAAGGACAGCAGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145883711 17:28368992-28369014 GCGCTTTGAGGATGGTGTCCTGG - Exonic
1148462055 17:47844536-47844558 CCTCTATGGGGATGGAGTGAGGG + Intergenic
1151632508 17:75320496-75320518 TCCCCAGGAGGATGGAGAGCTGG - Exonic
1152069383 17:78127486-78127508 GCCCTGGGATGATGGAATGCAGG - Intronic
1152387069 17:79980974-79980996 GCCCTTTGGGGTTGGGGTGCTGG - Intronic
1153198945 18:2630084-2630106 TCCTTGTGAGGATGAAGTGCTGG - Intergenic
1153992785 18:10414842-10414864 GCTCTATGATGAGGGAATGCTGG - Intergenic
1158414924 18:57241890-57241912 CTCCTATGAGGAGGGAGAGCAGG + Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1162479335 19:10919690-10919712 GGCCTGGGAGGATGGAGTGTGGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164255399 19:23523959-23523981 GCCCTATGTGGGTGAAGTTCAGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165382718 19:35492470-35492492 ACCCTATGCGGATGGAATGGTGG - Intronic
1165803516 19:38566904-38566926 TCCCTAGGTGGATGGAGTGGAGG + Exonic
925106246 2:1295045-1295067 GCCCTGTGCGCATGGAGTGCTGG + Intronic
925751701 2:7095434-7095456 ACCCTGTGAGGAGGGAGGGCAGG + Intergenic
925873729 2:8293866-8293888 GTGCTAGGGGGATGGAGTGCAGG + Intergenic
927516124 2:23672562-23672584 GCCTTATGAGGAAGGAGGGGTGG - Intronic
928621518 2:33092944-33092966 CCCCTAAAAGGAAGGAGTGCAGG - Intronic
933899676 2:86840475-86840497 GCCCTATGCGGATGAAGGGATGG - Intronic
935262259 2:101365407-101365429 TCCCTAGGAGGATGGAGTAGAGG - Intronic
935780885 2:106508751-106508773 GCCCTATGCGGATGAAGGGATGG + Intergenic
939011688 2:136854468-136854490 GCCTGATGGGGAAGGAGTGCGGG - Intronic
942730707 2:179057988-179058010 GCCCTATGAAGATGAAGTGATGG + Intergenic
945044663 2:205771221-205771243 GCCTTATGAGCATGGTGTGGCGG - Intronic
946291168 2:218746476-218746498 CTCCTATGAGGTTGGAGTTCAGG - Intronic
946391389 2:219418692-219418714 GCCGTAGGAGGAGGGCGTGCGGG - Exonic
948067856 2:235094958-235094980 GCGCTATGAGGATAAAGTGAAGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1169039713 20:2482965-2482987 GCCTTATGAGTATAGAGTACGGG - Exonic
1171127905 20:22620597-22620619 GCTCTAGGAGGCTGGGGTGCAGG - Intergenic
1173339247 20:42138919-42138941 GCACTGTGAGGCTGGAGTGGAGG - Intronic
1179815699 21:43904674-43904696 GCCCTATGACGACGGGCTGCAGG - Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1184268549 22:43364083-43364105 GGCCTAAGAGGATTGAGTGGGGG - Intergenic
1185179815 22:49352848-49352870 GCCCTCTGAGGCTGGAGTCATGG + Intergenic
953484901 3:43286340-43286362 GCCCAAGGAGGATGGAGGACGGG - Intergenic
955275865 3:57546200-57546222 CCCCTATGAGGCTGGGGTCCAGG - Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
961333997 3:126159296-126159318 GACCTGTGAGGAGGGTGTGCTGG - Intronic
962283568 3:134069407-134069429 GCCCAGGGAGCATGGAGTGCAGG - Intronic
965008733 3:163058320-163058342 TCCCTATGAGGCTGGAGTCCAGG + Intergenic
965607708 3:170512931-170512953 GGTCTATGAGGATGGAAGGCTGG + Intronic
966431243 3:179833083-179833105 TCCTTATGAGGATGGATTGTGGG + Intronic
968464128 4:742062-742084 GCCGCAGGTGGATGGAGTGCTGG - Intronic
969282342 4:6179197-6179219 GCCCTATGTGGCTGGAGAGAGGG + Intronic
969360169 4:6658369-6658391 GCCCTATGCGGATGAAGGGACGG + Intergenic
970125077 4:12800007-12800029 GGCCTATGAGGTTGGAGGGTGGG + Intergenic
978534435 4:109746031-109746053 GCCTTCTGAGCATGGGGTGCTGG + Intronic
980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG + Intergenic
980897641 4:138875229-138875251 GCCCTATAAGGATGGTCTGGAGG + Intergenic
981355775 4:143787454-143787476 TCCCTATGAAGATGGCTTGCAGG - Intergenic
981367313 4:143918111-143918133 TCCCTATGAAGATGGCTTGCAGG - Intergenic
981377099 4:144028344-144028366 TCCCTATGAAGATGGCTTGCAGG - Intergenic
985617308 5:931188-931210 GCTCTATGAGGATTTAGGGCCGG - Intergenic
985711535 5:1432321-1432343 GCACTAAAGGGATGGAGTGCAGG + Intronic
991927209 5:71717780-71717802 GCCATGTGAGGTTGGAGTGGAGG + Intergenic
996652365 5:125895257-125895279 GTCTTATGAGGATGGAGTGAAGG + Intergenic
997360721 5:133293088-133293110 GCCCTGTGGAGATGGAGTGGCGG - Intronic
998002398 5:138635392-138635414 GCCCTGTGAGGAGGGAGTTGGGG - Intronic
998337073 5:141382941-141382963 TCCCCAGGAGGATGGAGAGCAGG - Exonic
998653138 5:144143615-144143637 GCACAATGAGGATTCAGTGCTGG - Intergenic
1000234155 5:159342204-159342226 GCTCTATGAGGACAGAGTCCAGG - Intergenic
1002758838 6:186114-186136 GCCCTTTGTGGATGGACTACAGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007220578 6:40275734-40275756 GCCTTAGGAGGAGGGAGTGGAGG - Intergenic
1009610835 6:65938328-65938350 CCCCTATGAGGCTGGGGTCCAGG - Intergenic
1015400707 6:132785212-132785234 CCCCTAAGGGGATGGAGGGCTGG + Intronic
1017861173 6:158398480-158398502 GCCCTATGAGGAAGGAGCATGGG + Intronic
1018685582 6:166301788-166301810 GCTCTATGAGGACGCAGTGTGGG + Intergenic
1018782192 6:167078292-167078314 TCCCTGTGAGGATGCAGTGAAGG - Intergenic
1022034602 7:26521708-26521730 GCCCTAACACAATGGAGTGCTGG - Intergenic
1023988405 7:45111907-45111929 TCCGTATGAGGATGGCGTACTGG - Intronic
1025613447 7:63097832-63097854 TCCCTGTGAGGATGGTGTGTGGG - Intergenic
1027159703 7:75793354-75793376 GCTCTGTCAGGTTGGAGTGCAGG + Intergenic
1030327974 7:108241611-108241633 GGGCTATGAGGATGCAGTGGGGG - Intronic
1032984309 7:137319776-137319798 GCTGTATGAAGCTGGAGTGCAGG - Intronic
1034163282 7:149007644-149007666 ACTCTAGGAGGATGAAGTGCAGG + Intronic
1035223199 7:157418879-157418901 GCCCTAGGGGGATGGGGCGCTGG - Intergenic
1035695702 8:1593971-1593993 CCCCTATGTGGCTGGACTGCTGG - Intronic
1038067269 8:23975977-23975999 GCCATAAGAGGATGAAATGCTGG + Intergenic
1039739622 8:40370292-40370314 GCCCTATGGGAATGGGGTGGTGG - Intergenic
1041511829 8:58661300-58661322 GCCCTAAGGGGCTGGAGTGATGG + Intergenic
1042363910 8:67914570-67914592 GCCCTTTGAGAATGGGGTGTGGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1045856325 8:106769560-106769582 GCCCGAGCAGGATGGAGTGCAGG - Exonic
1046218206 8:111177791-111177813 GCCTTATGAGGATAAAGTTCAGG + Intergenic
1050581440 9:7061633-7061655 GCCCAATGAGGCAGGAGGGCAGG + Intronic
1052033195 9:23651453-23651475 GCCCTGTGGGGATGCAGTGGTGG + Intergenic
1052584775 9:30411939-30411961 CCCCTATGAGGCTGGGGTACAGG - Intergenic
1052994319 9:34542302-34542324 GTGCTTTGAGGATGGAGTACTGG - Intergenic
1053832311 9:42096139-42096161 GCACAATGAGGATGCTGTGCAGG + Intronic
1054598237 9:67091281-67091303 GCACAATGAGGATGCCGTGCAGG - Intergenic
1054912899 9:70470177-70470199 GACTTATGAGGATGGAGGGAAGG - Intergenic
1055164711 9:73176799-73176821 GCCCAAAGAAGATGGAGAGCTGG - Intergenic
1060206129 9:121683893-121683915 GCCCTGTGTGATTGGAGTGCTGG + Intronic
1060596645 9:124852792-124852814 GCCATCTGAGGATGGGGTGGAGG - Intergenic
1060727579 9:126016493-126016515 TCCCTGCCAGGATGGAGTGCTGG + Intergenic
1062176821 9:135167939-135167961 CGGCTGTGAGGATGGAGTGCTGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1189863485 X:45298000-45298022 CCCCAAGGAGGTTGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194385144 X:93243183-93243205 TCCCTATGAGGCTAGAGTCCAGG - Intergenic
1197178718 X:123511601-123511623 GCCCTGTGAGGATGAACTGCTGG - Intergenic
1199745642 X:150770617-150770639 GCCCTATGAGGATGGAGTGCCGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic