ID: 1199745963

View in Genome Browser
Species Human (GRCh38)
Location X:150772124-150772146
Sequence GGCTGAAAACACTGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 279}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199745963_1199745964 -4 Left 1199745963 X:150772124-150772146 CCAGCTTCTCAGTGTTTTCAGCC 0: 1
1: 0
2: 1
3: 30
4: 279
Right 1199745964 X:150772143-150772165 AGCCACCCCACAAACGTCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 96
1199745963_1199745972 20 Left 1199745963 X:150772124-150772146 CCAGCTTCTCAGTGTTTTCAGCC 0: 1
1: 0
2: 1
3: 30
4: 279
Right 1199745972 X:150772167-150772189 ACTCCTCCTGATTCTGGCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 196
1199745963_1199745970 14 Left 1199745963 X:150772124-150772146 CCAGCTTCTCAGTGTTTTCAGCC 0: 1
1: 0
2: 1
3: 30
4: 279
Right 1199745970 X:150772161-150772183 TGCGGGACTCCTCCTGATTCTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1199745963_1199745965 -3 Left 1199745963 X:150772124-150772146 CCAGCTTCTCAGTGTTTTCAGCC 0: 1
1: 0
2: 1
3: 30
4: 279
Right 1199745965 X:150772144-150772166 GCCACCCCACAAACGTCTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 55
1199745963_1199745974 25 Left 1199745963 X:150772124-150772146 CCAGCTTCTCAGTGTTTTCAGCC 0: 1
1: 0
2: 1
3: 30
4: 279
Right 1199745974 X:150772172-150772194 TCCTGATTCTGGCCCGGGCCAGG 0: 1
1: 0
2: 1
3: 39
4: 189
1199745963_1199745971 19 Left 1199745963 X:150772124-150772146 CCAGCTTCTCAGTGTTTTCAGCC 0: 1
1: 0
2: 1
3: 30
4: 279
Right 1199745971 X:150772166-150772188 GACTCCTCCTGATTCTGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199745963 Original CRISPR GGCTGAAAACACTGAGAAGC TGG (reversed) Intronic
900439374 1:2645715-2645737 GGCTGCAGCCACAGAGAAGCAGG - Intronic
901465143 1:9416665-9416687 GGCGGAAAGCAGTGAGACGCAGG + Intergenic
902099413 1:13973586-13973608 GGCTACAAACACTGGAAAGCTGG - Intergenic
902695701 1:18139447-18139469 GGCCGAAGACACTGGGAAGAGGG - Intronic
904492095 1:30867571-30867593 GGCTGACAGCACTCAGAAGATGG + Intergenic
905862026 1:41358237-41358259 GGCAGCAAGCACTGGGAAGCAGG + Intergenic
906674147 1:47681144-47681166 GGCTGAATGCACTGTGAGGCAGG + Intergenic
907369783 1:53993188-53993210 GGCTGCACACTCTGTGAAGCCGG - Intergenic
907529558 1:55080619-55080641 CACAGAAAACACTGAAAAGCTGG + Intronic
908377670 1:63560816-63560838 AGCTTAAAACATTTAGAAGCCGG - Intronic
908530861 1:65032720-65032742 GCATGAAGACACTGAGAAGATGG - Intergenic
908831134 1:68179637-68179659 GGCAGAAAATGCTGAGAAGCTGG + Intronic
910654147 1:89603083-89603105 GGCTGAATGCACTACGAAGCAGG + Intergenic
911375093 1:97042926-97042948 GGCTGAAATTACTCAGAATCTGG - Intergenic
912457144 1:109805843-109805865 GGCTGAAAACATTGGTAAGATGG - Intergenic
912523774 1:110265774-110265796 TCCTGAAAACACGGAGAAACTGG + Intronic
912851180 1:113126353-113126375 GTCAGAGAAGACTGAGAAGCAGG - Exonic
913011727 1:114689902-114689924 GACAGAAAACACTGAGGATCTGG - Intronic
913359679 1:117966215-117966237 GGCTGAAGACACTGATAAGGAGG + Exonic
913561478 1:120025280-120025302 GGCTGAAAAGACTGAGCAGAAGG + Intronic
913636650 1:120768321-120768343 GGCTGAAAAGACTGAGCAGAAGG - Intergenic
914282063 1:146184694-146184716 GGCTGAAAAGACTGAGCAGAAGG + Intronic
914543092 1:148635401-148635423 GGCTGAAAAGACTGAGCAGAAGG + Intronic
914623530 1:149435612-149435634 GGCTGAAAAGACTGAGCAGAAGG - Intergenic
915429427 1:155854584-155854606 AGCTGAAGACACTGAGATTCAGG - Intronic
916256385 1:162791925-162791947 GGCTGATAGCAATGAAAAGCTGG - Intronic
917920122 1:179743824-179743846 GGCTGAAAGCGCAGAGAAGCGGG - Intronic
917927763 1:179803411-179803433 GGCTGAAGTCACTGAGAACAGGG + Intronic
918238451 1:182601669-182601691 GGCTCAAAACACTTAGCAACTGG - Intronic
918544946 1:185671886-185671908 GGATGAGAACACTCAGAAGGAGG - Intergenic
919063176 1:192661164-192661186 AGGTGAGAAAACTGAGAAGCAGG - Intergenic
921496907 1:215853298-215853320 GGCTGGAGCCACTGAGAAACAGG + Intronic
921641426 1:217559594-217559616 GGGTAGAAACACTGAAAAGCAGG + Intronic
922174498 1:223186580-223186602 TGCTGAAAGCACAGAGAAGTTGG + Intergenic
923979416 1:239304051-239304073 AACTTAAAACACTGTGAAGCTGG + Intergenic
1064111375 10:12542174-12542196 GTTTTAAAACACTGAAAAGCTGG - Intronic
1064237781 10:13592296-13592318 GGGTGAAAAAGTTGAGAAGCCGG - Intronic
1064988291 10:21232751-21232773 TGCTCAAAACCCTGTGAAGCAGG - Intergenic
1065706526 10:28475976-28475998 AGCTGGAAACCCTGAGATGCTGG - Intergenic
1066992773 10:42531893-42531915 GGCTTAAAACACTGAGCACCAGG - Intergenic
1068199179 10:53761007-53761029 GGCTGAAGGCAAAGAGAAGCTGG + Intergenic
1070399436 10:76040386-76040408 GGCTGAACACAATGAGAAAAAGG - Intronic
1071742801 10:88379944-88379966 GGCTGGAAAGACTCAAAAGCTGG - Intronic
1073019680 10:100432529-100432551 GTTTTAAAAGACTGAGAAGCGGG - Intergenic
1074005968 10:109423826-109423848 GGCTGTAAAAATTGGGAAGCAGG - Intergenic
1074502557 10:114040229-114040251 GGCTGAATTCGCTGGGAAGCAGG + Intergenic
1074928059 10:118093754-118093776 GGCTGAAGATTCTGAGAAGCTGG + Intergenic
1076826998 10:132974120-132974142 GGTTGACAACCCTGGGAAGCCGG - Intergenic
1078536604 11:12179900-12179922 GGCTGAAGAAACAGAGAAGGAGG - Intronic
1080957721 11:37120135-37120157 GGCTGAAAACTCTGAGATCCTGG + Intergenic
1081332356 11:41819626-41819648 AGCTAAAAATACTGAGAAGGAGG + Intergenic
1084317350 11:68353322-68353344 GAGTGAAAACAGTGAGATGCCGG + Intronic
1084565974 11:69929257-69929279 TGCTGGGAACACTGAGAAGGAGG - Intergenic
1084843866 11:71883824-71883846 GCCCGAATACACTGGGAAGCTGG + Intronic
1085319699 11:75566361-75566383 GGCAGAAGGCGCTGAGAAGCAGG - Exonic
1089914460 11:122139423-122139445 GGCCAAACACACTCAGAAGCCGG + Intergenic
1090096474 11:123746749-123746771 TGCTGAAATTAATGAGAAGCTGG + Intergenic
1090166068 11:124548877-124548899 GTTTGAGAACACTGAGCAGCTGG - Intergenic
1090485831 11:127111076-127111098 GTCTGAAACCACTGAGATGGAGG - Intergenic
1090719500 11:129458876-129458898 GGCTGACAGCACAGAGCAGCAGG - Intergenic
1091531872 12:1365374-1365396 AGGTGAAAACACTGAACAGCGGG + Intronic
1091804075 12:3343499-3343521 GGCTCAAAGCACAGAGATGCAGG + Intergenic
1093402864 12:18767563-18767585 GTCTGAAAACACTGAGAAAGTGG - Intergenic
1094540979 12:31363040-31363062 GGCTGAGAAGACTGAGGAGATGG + Intergenic
1094630389 12:32168430-32168452 GGTTGAAACCACTGAGCAGTTGG - Intronic
1095283706 12:40385580-40385602 GCCTGAAAACACTGAGACCACGG + Intergenic
1096192205 12:49627145-49627167 GACTGAAAACACTGAAGGGCAGG - Intronic
1098393592 12:69995072-69995094 GGCTGTAAGCACTGTGAAGGAGG + Intergenic
1099563115 12:84204331-84204353 GGATGAAACAACTAAGAAGCTGG - Intergenic
1100588122 12:95998350-95998372 GGCTGAAATTACTCAGAAGCTGG - Intergenic
1101057686 12:100936036-100936058 TGCTGAAGATACTGAGAGGCTGG + Intronic
1101208838 12:102515798-102515820 GGCTGTAAACTCCGAGTAGCTGG + Intergenic
1101438275 12:104682812-104682834 GGCAGAAAGCACTGAGAATCAGG + Intronic
1103700356 12:122845977-122845999 GGCTGTAGACACAGAGATGCGGG - Intronic
1106315597 13:28590670-28590692 GACTGGAGACTCTGAGAAGCTGG + Intergenic
1106352740 13:28949358-28949380 TGCTGGAAACAGAGAGAAGCTGG - Intronic
1106906955 13:34419384-34419406 GAGAGAAAGCACTGAGAAGCTGG + Intergenic
1107595977 13:41963471-41963493 GACTGGATACACAGAGAAGCGGG + Intergenic
1107887301 13:44884503-44884525 CCCTGGAAACACTGAGAAACTGG + Intergenic
1108682194 13:52790127-52790149 GCCTGAAGACACTGAGATGGTGG - Intergenic
1109172067 13:59108603-59108625 GGCAGAAGACAAGGAGAAGCAGG - Intergenic
1109407193 13:61917900-61917922 GGCAGAAAGCAAAGAGAAGCAGG + Intergenic
1111208370 13:85042271-85042293 GACTTAATACACTGAGAAACTGG + Intergenic
1112798998 13:103089721-103089743 AGCTGAGAACACAGAGAAGGAGG + Intergenic
1114675292 14:24436254-24436276 GGGTGAAAACTCTGGGAAGGAGG + Intronic
1114804862 14:25823298-25823320 GGAAGAAAACGCTGGGAAGCTGG - Intergenic
1114854062 14:26416243-26416265 GGCTGATAAAACTGTGAAGTGGG + Intergenic
1117226244 14:53663322-53663344 GCCTGAAAACCCTGAGATGGGGG + Intergenic
1117448363 14:55826815-55826837 GGCTGAGTTCACTGAGAGGCAGG - Intergenic
1117674532 14:58142401-58142423 GGCTGAAGACAAAAAGAAGCCGG + Intronic
1118071621 14:62251941-62251963 GGCTGAAAAGGAAGAGAAGCTGG - Intergenic
1118767007 14:68916619-68916641 TGCTGCAAACGTTGAGAAGCCGG - Intronic
1119825713 14:77655514-77655536 GGCTGCAGAGGCTGAGAAGCAGG + Intergenic
1120798974 14:88668477-88668499 AGGTGAATACACTGAGAACCAGG + Intronic
1122375793 14:101256228-101256250 GAATGAAAAAAGTGAGAAGCAGG - Intergenic
1124104950 15:26729195-26729217 GTCTGAATACACTGTGCAGCGGG - Intronic
1124201610 15:27683030-27683052 GGCTGTAAAGTCTGAGAAGCAGG - Intergenic
1125975759 15:43950118-43950140 GGCTGAGACCACTGAGCAGTGGG - Intronic
1126554996 15:49976847-49976869 GGCAGAAAACACTAAGTGGCTGG - Intronic
1127173042 15:56323620-56323642 GGCTGAAAAAAGTGAGAAAAAGG + Intronic
1127207763 15:56738063-56738085 TACAGAAAACTCTGAGAAGCTGG + Intronic
1129137505 15:73567837-73567859 GGGTGAAAAATCTGAGATGCTGG - Intronic
1129348244 15:74938035-74938057 GGCTGAGGACAGAGAGAAGCCGG + Exonic
1130283402 15:82536514-82536536 GGCTGAAGACCCAGGGAAGCAGG + Intergenic
1131097051 15:89662839-89662861 TGTTCAAAATACTGAGAAGCAGG + Intergenic
1131691795 15:94835306-94835328 GGATCAAAACACAGAGAAGGTGG - Intergenic
1132106389 15:99065837-99065859 GGCTTAAAACAATGATCAGCTGG + Intergenic
1132888591 16:2193628-2193650 GGCTGAAATCTCGGAGAGGCTGG + Intronic
1133049629 16:3109944-3109966 GGCTTAAAACACCTAGAAGCCGG + Intergenic
1133267116 16:4591908-4591930 GGCTGAAAGCACTGAGGAGGAGG + Intronic
1137933488 16:52610588-52610610 GGCTGAACTCAATGAGAAGGTGG - Intergenic
1138701299 16:58866374-58866396 AGCTGAAACCTCTGAGTAGCTGG - Intergenic
1138851217 16:60632143-60632165 GGAGGAAAACACTGAGGGGCTGG + Intergenic
1139215223 16:65120954-65120976 GGTGGGAAGCACTGAGAAGCTGG - Intronic
1139245514 16:65438367-65438389 GCCAGAAGACACTGAGAAGCTGG - Intergenic
1139309563 16:66017094-66017116 GGCTGTAAACCCGGAGAGGCAGG + Intergenic
1140028320 16:71312104-71312126 GGATGGAAAAACAGAGAAGCTGG - Intergenic
1140225152 16:73071032-73071054 ATCTGAAAAAACTGAAAAGCGGG - Intergenic
1141199122 16:81883593-81883615 GGATGAGAAGACTGAGAAGATGG + Intronic
1141402967 16:83766935-83766957 GGCAGAAGACAAGGAGAAGCAGG - Intronic
1142735753 17:1898200-1898222 GGCTGCAAACACTAGGAAGAAGG - Exonic
1143504542 17:7356447-7356469 GGCTCAGAACACCCAGAAGCAGG - Exonic
1145413272 17:22692629-22692651 GGCTGACAGCACTGACAACCCGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147325945 17:39669681-39669703 GGCTGCAGGCACTGAGCAGCTGG - Exonic
1147745604 17:42692605-42692627 GGCTGAAATCAACGTGAAGCAGG + Exonic
1148460414 17:47836481-47836503 GGCTGAAAACCTTGGAAAGCAGG - Intronic
1148827367 17:50403841-50403863 GCCTGAAAGCACTGAGATCCAGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150270339 17:63860194-63860216 TGCTGAAAACACAGAGTAACGGG + Intergenic
1151343576 17:73487393-73487415 GGCTGAAGACACTGGCAAGAGGG + Intronic
1153850606 18:9090707-9090729 GGCTGAAAACACTGGCATACTGG + Intergenic
1154303404 18:13213971-13213993 GGCTGTACAGACTGAGATGCGGG + Intergenic
1155364003 18:25032561-25032583 GTCTGAAAGCCCTGAGAAACTGG - Intergenic
1155535484 18:26811991-26812013 GGGGGAAAACCATGAGAAGCAGG + Intergenic
1155875161 18:31077117-31077139 GAGAGAAAACAATGAGAAGCAGG + Intronic
1157340260 18:46771841-46771863 GGCTGAAGTCACAGAGGAGCAGG - Intergenic
1159909064 18:74126669-74126691 GACTGAAATCCCTGAGGAGCTGG + Intronic
1161147818 19:2689854-2689876 GGCTGAAAACACTGGGTATCTGG - Intronic
1163120475 19:15214235-15214257 GGCTGACAAGGCTGAGAGGCAGG - Intergenic
1164675845 19:30100824-30100846 GTCTGAAAACCTTGAGAACCAGG + Intergenic
1165783394 19:38446747-38446769 GGCTGGAGCCACTGAGAATCAGG + Exonic
1167669488 19:50841605-50841627 GGCAGAAAACCGTGAGAAACGGG + Intergenic
1168074370 19:53971563-53971585 GGCTGAAATCCCTGAGGAGGGGG - Intronic
925329063 2:3044139-3044161 GGCTGAGACCTCTGAGACGCAGG - Intergenic
925931929 2:8714917-8714939 GGCAGAAATCATTGAAAAGCTGG + Intergenic
928777754 2:34787502-34787524 ACCTGAAAACTATGAGAAGCAGG - Intergenic
930116076 2:47719371-47719393 GGCTGACATCACTGAGAGGCTGG + Intronic
934057217 2:88261510-88261532 GGCTGAAAGCTCTGAGAAAAGGG + Intergenic
935952824 2:108346320-108346342 GGCTAAAAACTCAGGGAAGCAGG + Intergenic
937656307 2:124380983-124381005 GGCTGGAATCTCTGAGAAGGTGG + Intronic
938097663 2:128474115-128474137 GGCTCAAACCCCTGAGGAGCAGG - Intergenic
938450255 2:131412265-131412287 TGCAGAAAACTCTGAAAAGCTGG + Intergenic
938600087 2:132828788-132828810 AGCACACAACACTGAGAAGCAGG + Intronic
939378542 2:141403011-141403033 GTATGAAGACATTGAGAAGCAGG + Intronic
941329623 2:164164138-164164160 GGCTGAAAACACTGGGGCCCTGG + Intergenic
945639114 2:212400014-212400036 GGCTGAAAGGACTGTGAACCAGG + Intronic
946257606 2:218457116-218457138 GACTGACAACACTGATGAGCCGG + Exonic
946676952 2:222170426-222170448 GGCTGAAGGCAATGAGGAGCAGG + Intergenic
948431313 2:237920919-237920941 GGCTGGGAACACTGAGAGACGGG - Intergenic
948657415 2:239485226-239485248 GGCTGAGAAGGCTGAGAAGATGG - Intergenic
1168971746 20:1936002-1936024 GGCTGAAGACACTGAGACCAAGG - Intronic
1169847957 20:10015886-10015908 GGCTGAAAACTGTGTCAAGCAGG - Intronic
1171054936 20:21897228-21897250 AGCTGAAAAGACTCAAAAGCTGG - Intergenic
1173682762 20:44897827-44897849 GGGTTAAAACATTGAGATGCTGG - Intronic
1174307512 20:49624644-49624666 GGCTGAACCCACTCAGAAGCTGG - Intergenic
1175841550 20:62031064-62031086 TGTTGAAAACACTGAGCACCTGG + Intronic
1175872450 20:62214877-62214899 TCCAGAAACCACTGAGAAGCAGG - Intergenic
1175905671 20:62378219-62378241 GGCTGGGAACCCTGAGGAGCTGG + Intergenic
1177213776 21:18103575-18103597 GCCTGAATACACTGAGAGACAGG - Intronic
1181786331 22:25229920-25229942 GTCTGAAAGCTATGAGAAGCAGG + Intronic
1181818502 22:25457743-25457765 GTCTGAAAGCTATGAGAAGCAGG + Intergenic
1182072568 22:27474090-27474112 AGGTGAAGAAACTGAGAAGCGGG - Intergenic
1182093228 22:27609929-27609951 GGCAGCAGACACGGAGAAGCCGG - Intergenic
1182137046 22:27915947-27915969 GGTTGAAAACACTGACAAGCAGG + Intronic
1182540299 22:31036506-31036528 GGCAGCAAAGCCTGAGAAGCTGG - Intergenic
1184073705 22:42162881-42162903 GGCAGAAAACACCAATAAGCAGG + Intronic
1184571478 22:45327725-45327747 GGCTGAAAACAAAGAAAATCTGG - Intronic
1185201558 22:49509173-49509195 AGCTGGATACCCTGAGAAGCCGG + Intronic
950304915 3:11910130-11910152 GGCTGGGCACACTGAGATGCCGG - Intergenic
955660949 3:61298540-61298562 GGCTGAAAGGCCTGAGAATCTGG - Intergenic
957362901 3:79182404-79182426 GGCTGAAATAACTGAAAAGATGG - Intronic
958719200 3:97823165-97823187 GGATGAAAAGACTCAGAAACAGG - Intronic
958879829 3:99657464-99657486 AGCTGATAAGACTGAGTAGCTGG + Intronic
962969405 3:140385081-140385103 GTTTGAAAACCCTGAGCAGCAGG + Intronic
963529731 3:146460027-146460049 GGCTGGACACACTGGGAAACAGG - Exonic
963777618 3:149455105-149455127 GTCTGAATATGCTGAGAAGCAGG - Intergenic
964803825 3:160584950-160584972 GGGTGAAAAAGTTGAGAAGCTGG + Intergenic
964926385 3:161963512-161963534 AGCTGAAAAAACTGGGATGCAGG - Intergenic
965166865 3:165205196-165205218 GTCTTAAAACACTGAGAACAGGG - Intergenic
966681221 3:182643870-182643892 AGCAGAAAACACTGAGAATTGGG + Intergenic
968273670 3:197423799-197423821 GGCTGAATCCAGTCAGAAGCTGG + Intergenic
970176327 4:13343086-13343108 TTCTGAGAATACTGAGAAGCAGG - Intergenic
971140261 4:23917617-23917639 AGATGAAAACACAGAAAAGCCGG - Intergenic
974250282 4:59376295-59376317 TCCTGACAACACTAAGAAGCAGG - Intergenic
976914709 4:90357854-90357876 AGCTTTAAAAACTGAGAAGCAGG - Intronic
977289990 4:95154784-95154806 GTCTGAACCCACTGGGAAGCAGG - Exonic
980347699 4:131643831-131643853 GACTGAACACACTGAGGAACTGG - Intergenic
981240781 4:142473969-142473991 GGCTGAGTACACACAGAAGCAGG - Intronic
981498390 4:145419341-145419363 GGTTGAGCAAACTGAGAAGCGGG - Intergenic
981653748 4:147088821-147088843 GGCTGAAAGCCCAGAGAACCTGG + Intergenic
982582960 4:157202727-157202749 GGCAGAAAACACTGAAAACAAGG + Intergenic
982642905 4:157985097-157985119 GGATGAATTCTCTGAGAAGCTGG - Intergenic
983567241 4:169166276-169166298 TGGTGAAAAAATTGAGAAGCTGG + Intronic
983859756 4:172691047-172691069 GGCTGAAAACATTCAGGAACTGG + Intronic
986978919 5:13423749-13423771 GGCAGAAAAAGCTGAGAATCAGG - Intergenic
989787100 5:45345186-45345208 GGCTGAAACAACTGGGATGCAGG + Intronic
989962218 5:50429903-50429925 GGGTGAAAAGACAGAGAAGGAGG - Intronic
991184699 5:63793792-63793814 GGCTTAAAAGACTGGGAACCAGG + Intergenic
991621741 5:68551847-68551869 GGCTGACAACACTGCCAGGCTGG - Intergenic
995593239 5:113721592-113721614 GGCTGAACAGAGTCAGAAGCTGG + Intergenic
996039514 5:118794417-118794439 GGCTGATAACACTGTGTATCAGG - Intergenic
996830304 5:127733252-127733274 GGCTGAGAACTCCCAGAAGCTGG + Intergenic
997023196 5:130026421-130026443 TGTTGAAAACACTGGTAAGCAGG + Intronic
997951457 5:138245880-138245902 GGCTGGGAACAGTGACAAGCAGG - Intergenic
998720671 5:144944601-144944623 GTCTGAAAATACTGAGAATATGG - Intergenic
999281149 5:150367007-150367029 GTATAAAAGCACTGAGAAGCTGG + Intronic
1000345442 5:160310461-160310483 AGGTAAAAACACTGAGTAGCTGG + Intronic
1001268130 5:170289994-170290016 GGCTGGAGACACAGAGGAGCAGG + Intronic
1001822318 5:174720163-174720185 GGCGGAAAACGGTGAGAAGTAGG + Intergenic
1003311603 6:4974037-4974059 GGCAGAAAGCACAGGGAAGCTGG + Intergenic
1006564659 6:34944928-34944950 CCATGAAAACACTGATAAGCTGG - Intronic
1007886977 6:45241025-45241047 GGATAAAAACACTTGGAAGCTGG + Intronic
1008076845 6:47154479-47154501 GGCTGAAAAGACTCAAAAGCGGG - Intergenic
1010456252 6:76059143-76059165 GGCTGAAAAGACTGCAAATCTGG + Intronic
1010635863 6:78258843-78258865 AGCTGAAAACTCTGAAAAGTTGG - Intergenic
1010731359 6:79394897-79394919 GGCTGCATGTACTGAGAAGCTGG + Intergenic
1013463855 6:110400162-110400184 GTCTGAAAACACAGAGATGATGG + Intronic
1013820367 6:114146966-114146988 AGCTGAATACACTGAGCAGCAGG + Intronic
1014398078 6:120951590-120951612 GAATGAAAGCACTGAGAAGGAGG - Intergenic
1014986511 6:128017666-128017688 AGCTGAAAACAGTGAGCAACAGG - Intronic
1015519382 6:134115261-134115283 GGCCCAAAACACTGGGAAGGAGG - Intergenic
1017038600 6:150289383-150289405 AGCAGAAACCACCGAGAAGCAGG + Intergenic
1017408164 6:154141815-154141837 GACTGAATACACTGGGAGGCAGG + Intronic
1020741739 7:12028549-12028571 GGCAGAAGACACTGTGAAGATGG + Intergenic
1021482281 7:21130877-21130899 GCATGAAAACATTTAGAAGCTGG - Intergenic
1021524983 7:21577112-21577134 AGCTGAAAACACTGGCAACCAGG + Intronic
1022131561 7:27409448-27409470 GGCTGGAAACACAGACAAGTGGG + Intergenic
1022138067 7:27467646-27467668 AGATGAAAACACAGAGCAGCAGG - Intergenic
1022728430 7:33001086-33001108 GTGTGAAAACACTGAAAAGAAGG - Intronic
1023256917 7:38321605-38321627 GGGTGAAAGTACTGAGAAGTGGG + Intergenic
1024353404 7:48390814-48390836 GGATGAAAACATAAAGAAGCTGG - Intronic
1025811730 7:64879977-64879999 GGCTGAAAACCCTGACAGCCTGG + Intronic
1026174304 7:67982507-67982529 GGATGAAAAGTCTGAGATGCAGG + Intergenic
1028048368 7:86152166-86152188 GGCTGGAGCCACTGAGATGCAGG - Intergenic
1028805053 7:95016395-95016417 GGATAAAAACATTGAAAAGCTGG + Intronic
1029866098 7:103630967-103630989 GGCTGAATTTACTGAGAAACTGG + Intronic
1030229180 7:107187834-107187856 GGCCTAAAAGACTGAGAATCAGG - Intronic
1031426824 7:121615441-121615463 GGCTAAAAACAAGAAGAAGCTGG - Intergenic
1031686841 7:124740541-124740563 GGCTGAAAAACCAGAGAAGTTGG - Intergenic
1033984926 7:147213720-147213742 GGCTGGAAACCCTGAGATGCTGG + Intronic
1034381204 7:150695026-150695048 TGCTGAAGACACTGAAAATCAGG + Intergenic
1035211460 7:157331527-157331549 GGCAGAAAATACAGAGAAGAGGG - Intergenic
1036202990 8:6784764-6784786 AGCTGAAAACACAGGAAAGCTGG + Intergenic
1037555959 8:20022801-20022823 GGCTGAAAACTTTCAAAAGCTGG - Intergenic
1038138664 8:24818788-24818810 GGCTGAGAGCACTGAGGAGCAGG - Intergenic
1038559392 8:28558300-28558322 AGCTGAAAATACTGATAAGGAGG + Intronic
1038886385 8:31667420-31667442 GACTGCAACCACTGAGGAGCAGG - Intronic
1039003448 8:33007520-33007542 GGATGAAAGCAAGGAGAAGCTGG - Intergenic
1040906854 8:52478100-52478122 AGATGAAAAAACTGAGATGCTGG + Intergenic
1041329670 8:56711251-56711273 GGCTGAAAACATTGTAAAACTGG - Intergenic
1041407225 8:57513361-57513383 AGCTGCAAACACAGGGAAGCTGG + Intergenic
1041529802 8:58852361-58852383 GACTCAAAACACTGATAGGCTGG + Intronic
1042985223 8:74575868-74575890 GCCTGAAAACACTAAGGTGCTGG - Intergenic
1043027021 8:75082906-75082928 GGGTGAAAACAGTGAAAAGCTGG - Intergenic
1044616762 8:94150356-94150378 GGCTGGAAGCAGGGAGAAGCAGG + Intronic
1044622395 8:94203025-94203047 GGGTGAAAAAGTTGAGAAGCCGG - Intronic
1046125583 8:109902497-109902519 GTCTGAAAATACTGAAAAGCAGG + Intergenic
1047024089 8:120808661-120808683 GGATGAAGACACTGAGACTCAGG + Intronic
1047211078 8:122840991-122841013 CCCGGAAAACACAGAGAAGCAGG + Intronic
1048752993 8:137700516-137700538 ACTTGAAAACACTGATAAGCAGG + Intergenic
1049743962 8:144255199-144255221 TGCTTAAAACACTGCCAAGCTGG - Intronic
1050138617 9:2494567-2494589 AGATGGAAACACTGAGATGCAGG + Intergenic
1050671339 9:8000768-8000790 GTGTGAAGATACTGAGAAGCTGG - Intergenic
1052682067 9:31706234-31706256 GGCTGGAAACCCAGGGAAGCTGG - Intergenic
1053400835 9:37820316-37820338 GGCTGAAACCACAGACCAGCTGG + Intronic
1055720098 9:79163746-79163768 GGCTTAGACCACTGAGAAGAGGG - Intergenic
1058447084 9:105064072-105064094 GGCTGAAAGGGCTGAGATGCGGG - Intergenic
1058615200 9:106818743-106818765 TACTGAAAACACTGAGGTGCAGG - Intergenic
1058857016 9:109072406-109072428 GGGTGAAAACACTGAAAGGGAGG - Intronic
1061965422 9:134011232-134011254 GCATCAAAACACCGAGAAGCAGG + Intergenic
1062059144 9:134485610-134485632 GGCTTAAAACACTGACTACCTGG + Intergenic
1062711217 9:137976143-137976165 GCCTGAAGACAGTGAGGAGCAGG + Intronic
1203612381 Un_KI270749v1:21399-21421 GACTTTGAACACTGAGAAGCAGG - Intergenic
1185824634 X:3238086-3238108 AGCTGAAAAAACTAAGAAGCAGG + Intergenic
1186672990 X:11785797-11785819 GGCTGAAATCACTGAAACCCTGG + Intergenic
1187007136 X:15243546-15243568 GGCTAATGACACTGAGAAACTGG + Intronic
1188192829 X:27193306-27193328 ATCTGAAAACACTGAGTAGCAGG - Intergenic
1188915837 X:35909393-35909415 GGATGAAAAAACTGTGAAACAGG - Intergenic
1189951338 X:46234341-46234363 GGCTGAGAAGGCTGAGAAACAGG + Intergenic
1195365285 X:104118389-104118411 GGCAAAAGACACTGAGAAGTAGG - Intronic
1195679246 X:107531432-107531454 GGATGAAAACACTCTGAACCAGG - Intronic
1196473251 X:116052599-116052621 GGCTTAAAAAACGGTGAAGCAGG - Intergenic
1198059084 X:133025727-133025749 GGCTGACAACACTAATGAGCCGG + Exonic
1198179167 X:134188306-134188328 GGCTAATAAAACTGAGAAACTGG - Intergenic
1199745963 X:150772124-150772146 GGCTGAAAACACTGAGAAGCTGG - Intronic
1200892107 Y:8335182-8335204 AGGTGAAAACACTCAGATGCTGG - Intergenic
1200917106 Y:8580852-8580874 GGCTGAAAACTCTGACAGGTTGG + Intergenic
1201254689 Y:12095724-12095746 AGCTGAAAAAACTAAGAAGCAGG - Intergenic
1202026022 Y:20524852-20524874 GGCAGAATAGAGTGAGAAGCAGG - Intergenic