ID: 1199746010

View in Genome Browser
Species Human (GRCh38)
Location X:150772318-150772340
Sequence CTGACCTCACCTGGTGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 209}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199746010_1199746017 1 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG 0: 1
1: 0
2: 2
3: 29
4: 209
Right 1199746017 X:150772342-150772364 AGGGGGCGCTGTAGGACCACAGG 0: 1
1: 0
2: 2
3: 8
4: 99
1199746010_1199746023 29 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG 0: 1
1: 0
2: 2
3: 29
4: 209
Right 1199746023 X:150772370-150772392 AGAGGCTGCTCCAGGCCTGCAGG 0: 1
1: 1
2: 3
3: 61
4: 493
1199746010_1199746016 -7 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG 0: 1
1: 0
2: 2
3: 29
4: 209
Right 1199746016 X:150772334-150772356 AGGTCAGCAGGGGGCGCTGTAGG 0: 1
1: 0
2: 2
3: 27
4: 299
1199746010_1199746022 21 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG 0: 1
1: 0
2: 2
3: 29
4: 209
Right 1199746022 X:150772362-150772384 AGGCTGGGAGAGGCTGCTCCAGG 0: 1
1: 2
2: 10
3: 80
4: 571
1199746010_1199746019 6 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG 0: 1
1: 0
2: 2
3: 29
4: 209
Right 1199746019 X:150772347-150772369 GCGCTGTAGGACCACAGGCTGGG 0: 1
1: 0
2: 1
3: 5
4: 114
1199746010_1199746020 11 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG 0: 1
1: 0
2: 2
3: 29
4: 209
Right 1199746020 X:150772352-150772374 GTAGGACCACAGGCTGGGAGAGG 0: 1
1: 0
2: 1
3: 36
4: 378
1199746010_1199746018 5 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG 0: 1
1: 0
2: 2
3: 29
4: 209
Right 1199746018 X:150772346-150772368 GGCGCTGTAGGACCACAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 128
1199746010_1199746024 30 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG 0: 1
1: 0
2: 2
3: 29
4: 209
Right 1199746024 X:150772371-150772393 GAGGCTGCTCCAGGCCTGCAGGG 0: 1
1: 0
2: 5
3: 63
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199746010 Original CRISPR CTGACCTCACCTGGTGCTCA TGG (reversed) Intronic
900241779 1:1620729-1620751 CTGACCTCAGCTTTTGCCCATGG - Intronic
901275217 1:7986016-7986038 CTGAGCTCACCTGGGTCACACGG - Intergenic
901728297 1:11259712-11259734 CTGACCTCAGGTGGTCCTCCAGG - Intronic
902621572 1:17653934-17653956 CTGCCCTCTGCTGGTGCTAAAGG - Intronic
902803503 1:18846250-18846272 CTCCCATCACCTGGTGGTCAGGG - Intronic
902812345 1:18895652-18895674 CTGACATCTCCTGGTGCAGAAGG - Intronic
903248954 1:22038270-22038292 CTGACCCCACGTGATGCTCTGGG - Intergenic
903325210 1:22565372-22565394 CAGACCTCTCCTGGTGCCCCGGG - Intronic
903965427 1:27086030-27086052 GTGACCCCAGCTGGGGCTCAGGG + Intergenic
904276060 1:29385024-29385046 CTGACCTCACCTGGAGGTCAAGG + Intergenic
904330262 1:29754009-29754031 CTGACCTCTCCTGGGGGTCAGGG + Intergenic
905625876 1:39490684-39490706 CTGACCTTTCCTGGCGCTCCAGG + Intergenic
905670997 1:39789642-39789664 CTGACCTTTCCTGGCGCTCCAGG - Intergenic
907911501 1:58831075-58831097 CTAACCTCCCCTGGGGCACATGG + Intergenic
907954234 1:59213172-59213194 CTGAGCTCATCTGGGGCTCTAGG + Intergenic
908036429 1:60059349-60059371 CTGACCTCAGCTGCTGCTCTGGG + Intronic
909431359 1:75590851-75590873 CTGAACCCACCTGGAGCTTAGGG + Intronic
910767191 1:90793472-90793494 CAGACCTCACCAGTTGATCAGGG - Intergenic
910973100 1:92876727-92876749 CTGATCTCACAAGGTGCCCAGGG - Intronic
911150235 1:94591324-94591346 TTCACCTCACCTGGTACTGACGG + Intergenic
914490214 1:148146909-148146931 TCGCCCTCACCTGGTGCGCAGGG - Intronic
915253079 1:154604384-154604406 CTCACCCCACCTGGATCTCATGG + Intronic
920213909 1:204348743-204348765 CTGACCTTAGCCTGTGCTCAAGG + Intronic
920335402 1:205241876-205241898 CAGCCCTCACCTGCTGCGCAAGG + Exonic
920963114 1:210681513-210681535 CTGACCTCTCCTGGTTCGCAGGG - Exonic
921390322 1:214608304-214608326 TTGCCCTCACCTGGTGCGCAGGG + Intronic
921479928 1:215652570-215652592 CTGACCTCACCTATTTCTGAGGG - Intronic
922773017 1:228198986-228199008 CTGTACCCACATGGTGCTCAAGG + Intergenic
924740208 1:246790433-246790455 CTGACCTCACCTGGAAAACAAGG - Intergenic
1062811717 10:471402-471424 CGGAACTCACCTGGTGGTCGAGG - Intronic
1062811723 10:471440-471462 CGGAACTCACCTGGTGTTCGAGG - Intronic
1063463899 10:6231068-6231090 CTGTCCGGACCTGGTGCTCTGGG + Intronic
1065274184 10:24068763-24068785 CTGACCTCTCTGGGTGCTGAGGG - Intronic
1065853761 10:29813396-29813418 CTCACCCCACCTGATGCTCTGGG - Intergenic
1067189802 10:44059625-44059647 CTGACCTCATCAAGAGCTCAAGG + Intergenic
1067743025 10:48910870-48910892 CAGAGCCCACCTGGTGCCCAGGG - Intronic
1069587057 10:69614121-69614143 GTAACCTCACCAGGTTCTCAAGG + Intergenic
1069593916 10:69658205-69658227 CTGACCTCACCGGGTGGTCCTGG - Intergenic
1069917252 10:71795334-71795356 CTAACTTCTCCTAGTGCTCATGG - Intronic
1070725143 10:78782609-78782631 CTGAGCTCAGCTGGTGCTGGAGG - Intergenic
1071518382 10:86314218-86314240 CTGCTTTCAGCTGGTGCTCAGGG + Intronic
1072958341 10:99906723-99906745 CTGCCATCATCTGGGGCTCAGGG - Intronic
1076107598 10:127835564-127835586 CTGTCCTCACCTGGCTTTCAGGG - Intergenic
1076219173 10:128719295-128719317 CACACCTCAGCTGGTGCTCTTGG + Intergenic
1076684790 10:132193495-132193517 CTGAGCTCACCACGTGCTCGTGG - Intronic
1077825702 11:5806298-5806320 CTGACCTCACACCTTGCTCATGG - Intronic
1078087463 11:8242867-8242889 CTCCCATCCCCTGGTGCTCATGG - Intronic
1078255725 11:9657050-9657072 CTGACCTCAAGTGGTTCTCCTGG + Intergenic
1084004155 11:66314461-66314483 CTGACCCCCACTGGTGCTTAAGG - Intergenic
1084541439 11:69789419-69789441 CTGGCCTGACCTGGTTCTCAGGG - Intergenic
1084763955 11:71295326-71295348 CAGAACTCAGCTGGTGATCATGG - Intergenic
1085700636 11:78742838-78742860 CCAACCTCAACTGTTGCTCAGGG + Intronic
1089347395 11:117799249-117799271 ATGACCTGACCAGGTGCTCTGGG - Intronic
1089397248 11:118144480-118144502 CTGACCTCAGAGGGTGCTGACGG - Intronic
1089638989 11:119834538-119834560 CTGACTTAACCCGGGGCTCAAGG - Intergenic
1089960663 11:122614613-122614635 CTCTCCTCACCTCGTTCTCACGG - Intergenic
1090029795 11:123196388-123196410 CTGCCCTGACCTTGTGCCCAGGG + Intergenic
1092929214 12:13299429-13299451 CTGAGCTTATCTGGTCCTCAAGG - Intergenic
1096558811 12:52421596-52421618 CTGACCTCCCCTGGAGCCCCAGG + Intergenic
1097408286 12:59218945-59218967 CTGAGCTCACATGGTGTTGATGG + Intergenic
1102415608 12:112759904-112759926 CTGCTCTCAGCTGGTTCTCAGGG - Intronic
1102517072 12:113456908-113456930 CTCACCCCAGCAGGTGCTCATGG - Intergenic
1102858548 12:116315759-116315781 ATGACCTGATCTGGTACTCAGGG - Intergenic
1104030842 12:125065196-125065218 CCGACCTCACCTGGAGCTGGAGG - Intergenic
1104209615 12:126676143-126676165 CCAACCTCACAGGGTGCTCATGG - Intergenic
1107411572 13:40162991-40163013 GGGACCTCACCTTGTGATCATGG + Intergenic
1107706786 13:43115894-43115916 CTGACCCCACTAGGTGTTCATGG - Intergenic
1113885344 13:113655969-113655991 CTGAGCCCAGCTGGTGCTGAAGG - Intronic
1114651088 14:24284929-24284951 CTGACCTCCCCTTCTACTCATGG + Intergenic
1116045616 14:39739773-39739795 CAGAGCTCAGCTGGTGCCCATGG + Intergenic
1117225426 14:53653659-53653681 GTGACCTGTCCTGGTGCTCTGGG - Intergenic
1118939116 14:70316361-70316383 CTGTCTTCACCTGGTAGTCAGGG + Intergenic
1124291761 15:28457602-28457624 TCGCCCTCACCTGGTGCGCAGGG + Intergenic
1126066407 15:44829484-44829506 CTGAGTTCACCTCTTGCTCACGG - Intergenic
1126093475 15:45071385-45071407 CTGAGTTCACCTCTTGCTCACGG + Intronic
1127935004 15:63628667-63628689 CATTCCTCACCTGGTGCTCTTGG + Exonic
1128161283 15:65424172-65424194 GTGATCTCATCTGGTCCTCAAGG + Intergenic
1129160578 15:73745417-73745439 CTGACCTCAGCTGGGGATCAGGG - Intronic
1132554688 16:567279-567301 ATGAGCTCATCTGGGGCTCAGGG + Intronic
1132878963 16:2152899-2152921 CTGTCCTCACCTGGGCCACAGGG + Intronic
1132982621 16:2746279-2746301 CTGCATTCTCCTGGTGCTCAAGG - Intergenic
1133239865 16:4407968-4407990 CTGACCTGACCTGGAGCCCGAGG - Intronic
1134033880 16:11014900-11014922 TTGACCTCCCCTGATGATCAGGG - Intronic
1135293755 16:21261976-21261998 CTGGCCTCACCTGGATCCCAGGG - Intronic
1136026211 16:27470641-27470663 GTGGCCTCACCTGGCGCTCCAGG + Intronic
1136188205 16:28600600-28600622 CGGACCTCCCCTGGAGCTCAAGG + Intergenic
1136190677 16:28613594-28613616 CGGACCTCCCCTGGAGCTCAAGG + Intronic
1136277939 16:29190642-29190664 TTGTCATCACCTGGTGCTCCAGG - Intergenic
1136707019 16:32200061-32200083 TCGCCCTCACCTGGTGCGCAGGG - Intergenic
1136760891 16:32729356-32729378 TCGCCCTCACCTGGTGCGCAGGG + Intergenic
1136807212 16:33141030-33141052 TCGCCCTCACCTGGTGCGCAGGG - Intergenic
1138207343 16:55134578-55134600 CAGCTCTCACCTGGGGCTCAGGG - Intergenic
1139910702 16:70395623-70395645 CTGCCCTTCCCTGGGGCTCAGGG - Intronic
1142082313 16:88156682-88156704 TTGTCATCACCTGGTGCTCCAGG - Intergenic
1203063043 16_KI270728v1_random:989670-989692 TCGCCCTCACCTGGTGCGCAGGG + Intergenic
1144457613 17:15432038-15432060 CTGACCTCACCCAGGTCTCATGG + Intergenic
1144633197 17:16886252-16886274 CTGACCTCTTCTGGTCCTGAAGG + Intergenic
1144776548 17:17787787-17787809 CTGGCCCCACCTGCTGTTCATGG - Intronic
1144998887 17:19289702-19289724 TCGGCCTCACCTGGCGCTCATGG + Intronic
1145190806 17:20841512-20841534 TCGCCCTCACCTGGTGCGCAGGG - Intronic
1145307217 17:21682028-21682050 CTGACCTCTCCTCGAGATCACGG + Intergenic
1145307667 17:21684358-21684380 CTGACCTCTCCTCGAGATCACGG + Intergenic
1146242671 17:31244541-31244563 CAGAGCTCAGCTGGTGCTCAAGG - Intronic
1146489680 17:33271371-33271393 CTGACCTCCTCTGGAGCTCCAGG + Intronic
1147637476 17:41972984-41973006 CTGACCTCACCCTGTCCTCCAGG + Intronic
1149866800 17:60155703-60155725 CTCTCCTGTCCTGGTGCTCAGGG + Intronic
1150346308 17:64407135-64407157 CTGCCCTGAGCTGGTGCTCTGGG + Intronic
1158494644 18:57943388-57943410 CTGAGCTCACCTGGAGCACCCGG + Intergenic
1159518442 18:69488135-69488157 ATGACCTCTTCTTGTGCTCAAGG + Intronic
1160404293 18:78634551-78634573 CTGTCCTCACCCGGGCCTCATGG + Intergenic
1160995398 19:1879911-1879933 TCGCCCTCACCTGGTGCGCAGGG + Exonic
1161319572 19:3634685-3634707 CTGGGCTCACCTGGAGCACAAGG - Intronic
1161355406 19:3816664-3816686 CTGACCTTACCTGGAGCTGCCGG + Exonic
1162566811 19:11449069-11449091 CTCACAGCACCTGGGGCTCATGG + Exonic
1162666701 19:12219801-12219823 CTGGACTCACCTGGGGCTTAGGG - Intergenic
1163326396 19:16606129-16606151 CTGACCTCACCTGCTGCCGTGGG - Intronic
1163595330 19:18218075-18218097 CTGAGATCACCTGGTGGACAGGG + Intronic
1163632869 19:18426071-18426093 CTGCCCCCACCTGGTCCTCATGG - Intronic
1165161178 19:33817377-33817399 TTGCCCTCACCTGGAGATCAGGG + Intergenic
1167490809 19:49791995-49792017 CTCGCCTGACCTGGTGCCCATGG + Exonic
926228814 2:10987393-10987415 CTGGCCTCACTTGGGGCTGAGGG + Intergenic
926706301 2:15840142-15840164 CTGCAGGCACCTGGTGCTCAGGG + Intergenic
926969687 2:18454110-18454132 CTGACTGCACCTGGTACACAGGG - Intergenic
929905694 2:46044406-46044428 CTGAGCTCATCTGGTGCTTTGGG + Intronic
930170254 2:48244503-48244525 CGGACCTCTGCTGGTGATCACGG - Intergenic
930230811 2:48841966-48841988 CCGAACTCAGCTGGTGCCCACGG - Intergenic
932415296 2:71569980-71570002 CTGGAGGCACCTGGTGCTCAGGG + Intronic
932620771 2:73263928-73263950 CAGGCCTCACCGGGTGCTCCGGG + Exonic
933707187 2:85300513-85300535 CTGGCGCCACCTGGTGGTCATGG + Intronic
936596677 2:113854793-113854815 ATGACCTCATCTGAGGCTCAGGG - Intergenic
938040523 2:128072203-128072225 CTGACCTCAGCTGCTTATCATGG + Intergenic
940515963 2:154684304-154684326 CTGCCCTGACCTAGTGCTCATGG - Intergenic
946333074 2:219021358-219021380 CTGTCCTCCCCTGGTGCCCAGGG - Intronic
947740848 2:232484222-232484244 CTGGCTTCACCTGGTCCCCAGGG - Exonic
948738972 2:240030566-240030588 CTGCTCTCTCCTGGTGCTCTGGG - Intergenic
1170781209 20:19427202-19427224 CCCACCTCACCTGGTGTTCCAGG - Intronic
1171155199 20:22865585-22865607 CTGAGCTGACTTGGTGCCCACGG + Intergenic
1173285025 20:41662587-41662609 CTGAGCTCCCCTAGTGCTTATGG - Intergenic
1174340106 20:49890157-49890179 CTGACCTCACCTGGCCGACAGGG - Exonic
1175861643 20:62153443-62153465 CTGACCTTACCTGGTGACCAGGG + Intronic
1175933702 20:62505456-62505478 CTGAGCTCACCCTGTGCTCTGGG - Intergenic
1176183776 20:63766970-63766992 CTGAGCCCACCTGCTGCTCTGGG + Intronic
1176359423 21:5982634-5982656 CACACCACACCTGCTGCTCAGGG - Intergenic
1176906102 21:14503438-14503460 GTGATCTCACCTGAGGCTCAGGG - Intronic
1179302838 21:40128041-40128063 CTGACCTAAGCTGGTGATCAGGG - Intronic
1179640281 21:42743427-42743449 ATGTCCTCAGCTGGTGCTTAGGG + Intronic
1179715197 21:43282696-43282718 CTGCCCACAGCAGGTGCTCAAGG - Intergenic
1179764095 21:43555916-43555938 CACACCACACCTGCTGCTCAGGG + Intronic
1180081412 21:45489444-45489466 CTGGCCCCAGCAGGTGCTCACGG + Intronic
1181121471 22:20670451-20670473 TCGCCCTCACCTGGTGCGCAGGG + Intergenic
1181334430 22:22117475-22117497 TCGCCCTCACCTGGTGCGCAGGG + Intergenic
1182478138 22:30588011-30588033 CAGACCTCACCTTGTATTCACGG + Exonic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
1185365686 22:50435696-50435718 CTGACCTCGCCAGGGGCTAATGG - Intronic
949554056 3:5137186-5137208 CTTACCTCACCATGAGCTCATGG - Intronic
949825027 3:8156299-8156321 CTGACATCATCTGTTGCTCAAGG - Intergenic
952411417 3:33053208-33053230 CTGGTCTCATCTGGTCCTCAGGG - Intronic
953418302 3:42735466-42735488 TCGACCTCACCTGGTTCTCAAGG - Intronic
953919495 3:46942247-46942269 GTGACCACACCTGGGGCCCAGGG + Intronic
954420654 3:50417438-50417460 CTGACATCAGCAGCTGCTCAGGG + Intronic
955185588 3:56711896-56711918 CTGGCCTCACCTGGTGGTATTGG + Intergenic
955467159 3:59249243-59249265 CTCAGCTCACATGGAGCTCATGG + Intergenic
956450183 3:69366454-69366476 GTGATCTCACCTCGTGATCATGG + Intronic
956634068 3:71345805-71345827 CTGCCCGCACCTGCTGTTCATGG - Intronic
962638908 3:137362233-137362255 CAGAACTCAGCTGGTGCTCATGG - Intergenic
963067790 3:141277667-141277689 CTGACCACACGTGGTGGTGAAGG + Intronic
963543984 3:146631656-146631678 CTATCTTCACCTGTTGCTCAGGG + Intergenic
963747797 3:149142869-149142891 CTGACCTCATCTTGAGGTCAGGG + Intronic
968503050 4:960089-960111 CTGCCCACACCTGCTGCCCAGGG + Exonic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
971083658 4:23244871-23244893 GTGACCTCATCTGAGGCTCAAGG - Intergenic
971102278 4:23480974-23480996 CTGACAAAACCTGGTGCTTAGGG - Intergenic
972613115 4:40673442-40673464 GTGTCCTCACCTAGAGCTCAGGG + Intergenic
973820788 4:54659615-54659637 CTGACCCCTCCTGCTGCACAGGG - Intronic
974236560 4:59188811-59188833 GTGACCTCACCTGAGGCTCAGGG - Intergenic
975495881 4:75035510-75035532 TTGACCCCACGTGGAGCTCATGG + Intronic
978862791 4:113470665-113470687 CTGACCTAACATGAGGCTCAGGG - Intronic
979530308 4:121763840-121763862 CTGCCCTTGACTGGTGCTCAGGG - Exonic
982719643 4:158847019-158847041 CAGAGCTCAGCTGGTGCCCACGG + Intronic
986345082 5:6827198-6827220 CTGAGCTCAGCTGCTGCTCTTGG + Intergenic
987537297 5:19206043-19206065 CAGAACTCAGCTGGTGCCCACGG + Intergenic
987831002 5:23095272-23095294 CTGACCTCTCCTGGTCTTTATGG + Intergenic
988520897 5:31944833-31944855 CACAGCTCACCTGGTGCACATGG - Intronic
989164967 5:38424882-38424904 CTGACCCCACCAGCAGCTCATGG - Intronic
991608734 5:68428920-68428942 CTCACCTCACAGGGTGCCCATGG + Intergenic
997824297 5:137092508-137092530 CTGACCTCACCTGGGTATCAGGG - Intronic
1001038720 5:168316552-168316574 CTGCCCTCACCTGGACCTCCTGG - Intronic
1001292197 5:170471670-170471692 CTGAACTGAACTGCTGCTCAGGG + Intronic
1001602937 5:172940706-172940728 CTTAACTCAAGTGGTGCTCAGGG + Intronic
1002640787 5:180629686-180629708 CTGACCTCACCTGCTTCCCTGGG + Exonic
1004017414 6:11744684-11744706 CTGGCTTCACATGGTGCACATGG + Intronic
1005670957 6:28105574-28105596 GAGACCACACCTGGTGCTCAGGG - Intergenic
1005973825 6:30782021-30782043 CTGACGTCACCTGGTCCAGATGG - Intergenic
1006608966 6:35281079-35281101 CTGACCTCAGCTGTGGCTCTTGG + Exonic
1007118379 6:39360630-39360652 CAGAGCTGCCCTGGTGCTCAGGG + Intronic
1008542612 6:52558274-52558296 CTGCTCCCACCTGGTGCTCCCGG - Intronic
1015938124 6:138423285-138423307 ATGACCTCAGCTGCTACTCAAGG + Exonic
1018446157 6:163860820-163860842 CTGCCCTCACTTGCTGCTCTGGG - Intergenic
1018899473 6:168043967-168043989 ATGCCCACACCTGCTGCTCACGG - Intronic
1018974980 6:168557733-168557755 TTGACGTCACCAGTTGCTCATGG + Intronic
1019017071 6:168887849-168887871 CTGACCTCACCTGTGCCTCTGGG + Intergenic
1019135993 6:169908001-169908023 GAGACCCCACCTGGTGCTCAGGG + Intergenic
1019409078 7:898807-898829 CTGGCCCCACCTGCTCCTCAGGG - Exonic
1019524577 7:1474975-1474997 CTGCCCTCCCGAGGTGCTCATGG - Intronic
1020469176 7:8516515-8516537 CAGATATCACCTGGTGCTCAAGG + Intronic
1021224896 7:18015165-18015187 TTCACATCACCTGGGGCTCAGGG + Intergenic
1022238617 7:28487698-28487720 CTCATTTCACCTGTTGCTCAGGG + Intronic
1023647864 7:42337681-42337703 CTCACCTGACCTGAGGCTCAGGG + Intergenic
1034545986 7:151789712-151789734 CTGACATCACCTGGGGAGCATGG + Intronic
1035663555 8:1364285-1364307 CTGTCCCCACCTGGAGCACAGGG - Intergenic
1037494742 8:19427928-19427950 CTTCCCTCACCTGGGGCACAGGG - Intronic
1042078375 8:65021130-65021152 CTGAGTGCACCTGGTGTTCAAGG - Intergenic
1047360850 8:124167785-124167807 CTGATTTCACCTGGTACTCCAGG - Intergenic
1047969792 8:130074816-130074838 CTGACCTCACATGGTCATCTGGG - Intronic
1048008509 8:130438380-130438402 CTGACCTCTCCTGGGGCCAATGG + Intronic
1049040944 8:140111258-140111280 CTGACCTCACCTGAGCCTCAGGG - Intronic
1049622183 8:143603519-143603541 CTGAGCTCACCTAGTGCCCAGGG + Intergenic
1051492578 9:17683251-17683273 CAGACCTCACCTTGTGCTCATGG + Intronic
1052560685 9:30079343-30079365 CTGAGTTCAACTGGTGCCCAGGG - Intergenic
1052682729 9:31715227-31715249 CACACCTCACCTAGTGCTGAAGG + Intergenic
1053423531 9:37996317-37996339 CTGAGCTTAGCTGGTACTCATGG + Intronic
1056983895 9:91343206-91343228 CTAACCTCTCATGTTGCTCAAGG + Intronic
1057939246 9:99266492-99266514 CTGACCTTACCTGGAGTTCAGGG - Intergenic
1060733569 9:126052451-126052473 CAGGGCTCACCTGGTCCTCAAGG - Intergenic
1062290421 9:135791915-135791937 CAGTGCCCACCTGGTGCTCAGGG - Intronic
1186223040 X:7369896-7369918 CTGGTCTCACCTGGAGCTGAAGG + Intergenic
1188071912 X:25727613-25727635 CAGAACTCAGCTGGTGATCATGG - Intergenic
1191968578 X:66788643-66788665 GTAACATCACCTGGTTCTCAAGG + Intergenic
1192374762 X:70548677-70548699 CAGAACTCAACTGATGCTCATGG + Intronic
1194095650 X:89636082-89636104 CAGAACTCAGCTGGTGCTCATGG + Intergenic
1195112535 X:101661631-101661653 CTGACCTCATCAGTTTCTCAAGG + Intergenic
1195942866 X:110179774-110179796 CAGACCCCACCTGGCCCTCAAGG - Intronic
1196190939 X:112793714-112793736 CTCACCTCAACTGGTTTTCAAGG - Intronic
1197514692 X:127411195-127411217 CAGAACTCACCTGGTGCCCTTGG - Intergenic
1197577859 X:128242196-128242218 CAGACATCATCTGATGCTCAAGG + Intergenic
1197987069 X:132278231-132278253 CTGGACTCACCTGGGGCTCGGGG - Intergenic
1198024844 X:132694868-132694890 CTGTCCTTACCAGTTGCTCAGGG - Intronic
1199388106 X:147246938-147246960 GTGATCTCATCTGGGGCTCAAGG - Intergenic
1199746010 X:150772318-150772340 CTGACCTCACCTGGTGCTCATGG - Intronic
1200448649 Y:3297450-3297472 CAGAGCTCAGCTGGTGCTCATGG + Intergenic
1201592631 Y:15632231-15632253 CTGATCTCACCTGGAGCTGGAGG + Intergenic