ID: 1199746010

View in Genome Browser
Species Human (GRCh38)
Location X:150772318-150772340
Sequence CTGACCTCACCTGGTGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199746010_1199746020 11 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG No data
Right 1199746020 X:150772352-150772374 GTAGGACCACAGGCTGGGAGAGG No data
1199746010_1199746022 21 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG No data
Right 1199746022 X:150772362-150772384 AGGCTGGGAGAGGCTGCTCCAGG No data
1199746010_1199746024 30 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG No data
Right 1199746024 X:150772371-150772393 GAGGCTGCTCCAGGCCTGCAGGG No data
1199746010_1199746017 1 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG No data
Right 1199746017 X:150772342-150772364 AGGGGGCGCTGTAGGACCACAGG No data
1199746010_1199746019 6 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG No data
Right 1199746019 X:150772347-150772369 GCGCTGTAGGACCACAGGCTGGG No data
1199746010_1199746018 5 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG No data
Right 1199746018 X:150772346-150772368 GGCGCTGTAGGACCACAGGCTGG No data
1199746010_1199746023 29 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG No data
Right 1199746023 X:150772370-150772392 AGAGGCTGCTCCAGGCCTGCAGG No data
1199746010_1199746016 -7 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG No data
Right 1199746016 X:150772334-150772356 AGGTCAGCAGGGGGCGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199746010 Original CRISPR CTGACCTCACCTGGTGCTCA TGG (reversed) Intronic