ID: 1199746016

View in Genome Browser
Species Human (GRCh38)
Location X:150772334-150772356
Sequence AGGTCAGCAGGGGGCGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199746003_1199746016 4 Left 1199746003 X:150772307-150772329 CCAATCCCGCCCCATGAGCACCA No data
Right 1199746016 X:150772334-150772356 AGGTCAGCAGGGGGCGCTGTAGG No data
1199746000_1199746016 13 Left 1199746000 X:150772298-150772320 CCAACCGGCCCAATCCCGCCCCA No data
Right 1199746016 X:150772334-150772356 AGGTCAGCAGGGGGCGCTGTAGG No data
1199746006_1199746016 -2 Left 1199746006 X:150772313-150772335 CCGCCCCATGAGCACCAGGTGAG No data
Right 1199746016 X:150772334-150772356 AGGTCAGCAGGGGGCGCTGTAGG No data
1199746002_1199746016 5 Left 1199746002 X:150772306-150772328 CCCAATCCCGCCCCATGAGCACC No data
Right 1199746016 X:150772334-150772356 AGGTCAGCAGGGGGCGCTGTAGG No data
1199746001_1199746016 9 Left 1199746001 X:150772302-150772324 CCGGCCCAATCCCGCCCCATGAG No data
Right 1199746016 X:150772334-150772356 AGGTCAGCAGGGGGCGCTGTAGG No data
1199746010_1199746016 -7 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG No data
Right 1199746016 X:150772334-150772356 AGGTCAGCAGGGGGCGCTGTAGG No data
1199746008_1199746016 -5 Left 1199746008 X:150772316-150772338 CCCCATGAGCACCAGGTGAGGTC No data
Right 1199746016 X:150772334-150772356 AGGTCAGCAGGGGGCGCTGTAGG No data
1199746009_1199746016 -6 Left 1199746009 X:150772317-150772339 CCCATGAGCACCAGGTGAGGTCA No data
Right 1199746016 X:150772334-150772356 AGGTCAGCAGGGGGCGCTGTAGG No data
1199746005_1199746016 -1 Left 1199746005 X:150772312-150772334 CCCGCCCCATGAGCACCAGGTGA No data
Right 1199746016 X:150772334-150772356 AGGTCAGCAGGGGGCGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199746016 Original CRISPR AGGTCAGCAGGGGGCGCTGT AGG Intronic