ID: 1199746022

View in Genome Browser
Species Human (GRCh38)
Location X:150772362-150772384
Sequence AGGCTGGGAGAGGCTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199746009_1199746022 22 Left 1199746009 X:150772317-150772339 CCCATGAGCACCAGGTGAGGTCA No data
Right 1199746022 X:150772362-150772384 AGGCTGGGAGAGGCTGCTCCAGG No data
1199746010_1199746022 21 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG No data
Right 1199746022 X:150772362-150772384 AGGCTGGGAGAGGCTGCTCCAGG No data
1199746008_1199746022 23 Left 1199746008 X:150772316-150772338 CCCCATGAGCACCAGGTGAGGTC No data
Right 1199746022 X:150772362-150772384 AGGCTGGGAGAGGCTGCTCCAGG No data
1199746006_1199746022 26 Left 1199746006 X:150772313-150772335 CCGCCCCATGAGCACCAGGTGAG No data
Right 1199746022 X:150772362-150772384 AGGCTGGGAGAGGCTGCTCCAGG No data
1199746015_1199746022 12 Left 1199746015 X:150772327-150772349 CCAGGTGAGGTCAGCAGGGGGCG No data
Right 1199746022 X:150772362-150772384 AGGCTGGGAGAGGCTGCTCCAGG No data
1199746005_1199746022 27 Left 1199746005 X:150772312-150772334 CCCGCCCCATGAGCACCAGGTGA No data
Right 1199746022 X:150772362-150772384 AGGCTGGGAGAGGCTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199746022 Original CRISPR AGGCTGGGAGAGGCTGCTCC AGG Intronic