ID: 1199746023

View in Genome Browser
Species Human (GRCh38)
Location X:150772370-150772392
Sequence AGAGGCTGCTCCAGGCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199746009_1199746023 30 Left 1199746009 X:150772317-150772339 CCCATGAGCACCAGGTGAGGTCA No data
Right 1199746023 X:150772370-150772392 AGAGGCTGCTCCAGGCCTGCAGG No data
1199746015_1199746023 20 Left 1199746015 X:150772327-150772349 CCAGGTGAGGTCAGCAGGGGGCG No data
Right 1199746023 X:150772370-150772392 AGAGGCTGCTCCAGGCCTGCAGG No data
1199746010_1199746023 29 Left 1199746010 X:150772318-150772340 CCATGAGCACCAGGTGAGGTCAG No data
Right 1199746023 X:150772370-150772392 AGAGGCTGCTCCAGGCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199746023 Original CRISPR AGAGGCTGCTCCAGGCCTGC AGG Intronic