ID: 1199746657

View in Genome Browser
Species Human (GRCh38)
Location X:150776039-150776061
Sequence CAGACTTCCTGGGACGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 280}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199746657_1199746672 10 Left 1199746657 X:150776039-150776061 CCACCCCCGTCCCAGGAAGTCTG 0: 1
1: 0
2: 3
3: 30
4: 280
Right 1199746672 X:150776072-150776094 GGTCTCAGGCAGGCTGTGGAGGG 0: 1
1: 1
2: 4
3: 33
4: 414
1199746657_1199746669 0 Left 1199746657 X:150776039-150776061 CCACCCCCGTCCCAGGAAGTCTG 0: 1
1: 0
2: 3
3: 30
4: 280
Right 1199746669 X:150776062-150776084 CTTGGGAGTGGGTCTCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 327
1199746657_1199746671 9 Left 1199746657 X:150776039-150776061 CCACCCCCGTCCCAGGAAGTCTG 0: 1
1: 0
2: 3
3: 30
4: 280
Right 1199746671 X:150776071-150776093 GGGTCTCAGGCAGGCTGTGGAGG 0: 1
1: 0
2: 3
3: 59
4: 592
1199746657_1199746674 27 Left 1199746657 X:150776039-150776061 CCACCCCCGTCCCAGGAAGTCTG 0: 1
1: 0
2: 3
3: 30
4: 280
Right 1199746674 X:150776089-150776111 GGAGGGATCTGGATCTGTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 178
1199746657_1199746673 16 Left 1199746657 X:150776039-150776061 CCACCCCCGTCCCAGGAAGTCTG 0: 1
1: 0
2: 3
3: 30
4: 280
Right 1199746673 X:150776078-150776100 AGGCAGGCTGTGGAGGGATCTGG 0: 1
1: 0
2: 2
3: 51
4: 449
1199746657_1199746668 -4 Left 1199746657 X:150776039-150776061 CCACCCCCGTCCCAGGAAGTCTG 0: 1
1: 0
2: 3
3: 30
4: 280
Right 1199746668 X:150776058-150776080 TCTGCTTGGGAGTGGGTCTCAGG 0: 1
1: 0
2: 1
3: 16
4: 223
1199746657_1199746670 6 Left 1199746657 X:150776039-150776061 CCACCCCCGTCCCAGGAAGTCTG 0: 1
1: 0
2: 3
3: 30
4: 280
Right 1199746670 X:150776068-150776090 AGTGGGTCTCAGGCAGGCTGTGG 0: 1
1: 0
2: 3
3: 52
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199746657 Original CRISPR CAGACTTCCTGGGACGGGGG TGG (reversed) Intronic
900106228 1:982261-982283 ACGACTTCCTGGCACGGGGCCGG + Intergenic
900371809 1:2335547-2335569 GAGCCCTCCTGGGACAGGGGTGG - Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901862585 1:12084381-12084403 CAGGCCTCCTGGGACTGGTGGGG + Intronic
902704018 1:18191992-18192014 CAGCCCTCCTGGGCCGGGGAGGG + Intronic
903220182 1:21865066-21865088 CAGAATTCCTGGGTTGGGGGTGG + Exonic
903884233 1:26531644-26531666 CGGACTTCCTGGGATTGGTGGGG + Intronic
904125237 1:28233680-28233702 CAGAATTTCTGGAACCGGGGAGG - Intergenic
904282984 1:29434320-29434342 CTCACTTCCTGGGAATGGGGGGG - Intergenic
905975533 1:42171197-42171219 CAGACTCCCTGGGATGAGGGAGG + Intergenic
906017339 1:42593549-42593571 CAGACTTCCCAGGAAGGGAGAGG - Intronic
906210595 1:44010537-44010559 CAGACTGCCAGGGTCTGGGGTGG + Intronic
908026230 1:59954574-59954596 CAGTCTTGGTGGGTCGGGGGGGG + Intergenic
909261545 1:73495671-73495693 TAGAATTCCTGGGCCGGGCGCGG - Intergenic
910043598 1:82884909-82884931 TAGACTTCCTGGGTCGAGTGGGG - Intergenic
912787459 1:112618876-112618898 CAGACCTCCTGGGGCAGGGCGGG - Intronic
913212353 1:116592146-116592168 CTGACTTACTGGGTCTGGGGTGG - Intronic
915604779 1:156943710-156943732 CAGACAACCTGGCACAGGGGTGG - Intronic
915677635 1:157546547-157546569 CAGACTTTCTGGTACCGGAGAGG + Intronic
915978666 1:160407016-160407038 CAGACCCCCTGGGCCGGGCGTGG - Intronic
916517465 1:165532967-165532989 CAGATTCCTTGGGACGGGAGTGG - Intergenic
916560322 1:165929364-165929386 AAGACTTCCTGAGAGGGGAGTGG + Intergenic
916571260 1:166029778-166029800 CAGACTGCCTGGGAAGGCTGGGG + Intergenic
918312167 1:183292730-183292752 GAGACTTACTGGGAGTGGGGTGG - Intronic
922445799 1:225696199-225696221 CAGGCTTCAAGGGATGGGGGTGG + Intergenic
922455063 1:225767902-225767924 CTAACTTCCTGGGGCGGGGGTGG - Intergenic
924865724 1:247978034-247978056 TGGACTTCCTGGGTCGGGTGGGG + Intronic
1063229173 10:4047121-4047143 CCAACTTCCTGGGAAGGTGGGGG - Intergenic
1063457006 10:6190866-6190888 CAGAATTCCTTGAACCGGGGAGG - Intronic
1066982164 10:42426896-42426918 GAGACTTACTGGGCCGGGTGCGG + Intergenic
1068312162 10:55292670-55292692 TTGACTGCCTGGGACGGGTGTGG - Intronic
1069902243 10:71712976-71712998 CACACTCCCTGGGATGGGAGAGG - Exonic
1070591984 10:77807941-77807963 CATACTGCCAGGGATGGGGGTGG + Exonic
1071455653 10:85849664-85849686 CAGATTTCCTGGGAGTGAGGGGG - Intronic
1075142329 10:119850322-119850344 GAGACTTCTGGGGACGGAGGAGG + Intronic
1075406563 10:122199470-122199492 GAGACTTCCTGGCATGGGGTGGG + Intronic
1075731371 10:124638684-124638706 CAGGCATGCTGGGGCGGGGGAGG + Intronic
1075817900 10:125279945-125279967 CAGACTTCCTGGGGGGTGGCAGG + Intergenic
1076299612 10:129415075-129415097 CACAGTTCCTGGTACTGGGGTGG - Intergenic
1076685733 10:132197710-132197732 GAGACTTCGTGGGACGGGACGGG + Intronic
1076783690 10:132738590-132738612 CAGACTTTCTGGGAAGAAGGCGG - Intronic
1077046835 11:550407-550429 CAGACTTCCAGTGACAGAGGAGG - Intronic
1078654223 11:13223193-13223215 CAGCCTTCCTGGGATGGGGGTGG - Intergenic
1079469819 11:20767587-20767609 TAGACTTCCTGGGTCGAGTGGGG - Intronic
1081732414 11:45380857-45380879 GTGACTTCCTGGGTCGGGCGTGG - Intergenic
1083570555 11:63759577-63759599 CTGACTTCCTGGGAGGGCAGAGG - Exonic
1083728444 11:64640550-64640572 GAGAGTTCCTGGGGAGGGGGAGG + Intronic
1084311272 11:68317545-68317567 CTGCCTTCCTGGGTTGGGGGTGG + Intronic
1084320271 11:68369738-68369760 CAGAGTTCCAGGAACGGGTGTGG + Intronic
1084854718 11:71975486-71975508 CAGCCTTCCTTGGAGGGGGGTGG + Intronic
1085196759 11:74677262-74677284 CAGGCTTCCAGGGGCGGGGGTGG - Intergenic
1085199178 11:74691408-74691430 AAGACTTACTGGGAATGGGGAGG + Intergenic
1085401536 11:76238758-76238780 CAGACTTCCTGGAGCCAGGGAGG + Intergenic
1087755601 11:102051448-102051470 CAGCCTCCCTGGGATGTGGGAGG - Intronic
1088320918 11:108554032-108554054 CAGACTTCCTGGGATGAATGTGG + Intronic
1089302513 11:117507288-117507310 CAGGCTTCCAGGGAGGGGTGCGG - Intronic
1089339054 11:117745213-117745235 GAGGCTACCTGGGGCGGGGGTGG + Intronic
1090946000 11:131430314-131430336 AAGAGTTCCAGGGATGGGGGTGG + Intronic
1096273824 12:50188765-50188787 CAGACTTCCTTGTACTGGGTGGG - Intronic
1098450428 12:70612606-70612628 CAGACTACATGGGAAGGGTGGGG + Intronic
1098591262 12:72215778-72215800 CTGAATTCCTGGGATGGGGGTGG + Intronic
1102225313 12:111224318-111224340 CAGGCTTCCTGAGAGGGGAGTGG + Intronic
1102884200 12:116509013-116509035 CAGGCTTCCTGGAAGGAGGGAGG - Intergenic
1104692297 12:130836133-130836155 CACATTTCCTGGGGCGGGGCGGG + Intronic
1105215597 13:18282769-18282791 CTGACTTACTGGGTCTGGGGTGG - Intergenic
1106123770 13:26883261-26883283 AAGACTCCCTGGGAGGGGGTGGG - Intergenic
1106618582 13:31352819-31352841 CTGAGCTCCTGGGACGGGAGCGG + Intergenic
1109741390 13:66560294-66560316 CAGACTGCATGGGAAGGGGGAGG + Intronic
1110707366 13:78610113-78610135 GAGACTTACTGGGAGGTGGGAGG - Intergenic
1119443135 14:74642298-74642320 CAGACTTGCTGGGCCGGGCCAGG - Intergenic
1119882865 14:78114837-78114859 CAGAATGCCTGGGATGGGGCTGG - Intergenic
1121144043 14:91568166-91568188 TGGACTTCCTGGGTCGGGTGGGG - Intergenic
1122128326 14:99591100-99591122 CAGCCTCCCTGGGAGGGAGGGGG + Intronic
1122200171 14:100117627-100117649 CAGGATTCCTAGGACGAGGGAGG + Intronic
1122297421 14:100713286-100713308 CAGACCTCCTTGGACAGGGTTGG - Intergenic
1122357430 14:101132092-101132114 CAGGCTTCCTGGGGCAGGGCAGG + Intergenic
1122703458 14:103605702-103605724 CAGACCACCAGGGACAGGGGAGG - Intronic
1122959659 14:105088550-105088572 CAGGCTGCCTGGGAGGGGGAGGG - Intergenic
1123062626 14:105601148-105601170 CAGTCGTCCTGCGACGGCGGCGG - Intergenic
1124196845 15:27639107-27639129 GAGACTGCCTAAGACGGGGGAGG + Intergenic
1124713390 15:32033083-32033105 CAGAGGTCATGGGAAGGGGGCGG + Intronic
1126804859 15:52337710-52337732 GAGACTTCCTGGGAGGGGGCAGG + Intronic
1127547546 15:60004808-60004830 CAGACTTCGGGGGTCGGGGGTGG - Intronic
1128264553 15:66254789-66254811 CACATTTCCTGGGAAGGGGTAGG - Intergenic
1128397809 15:67246583-67246605 TAGACTTCCTGGGTCGAGTGGGG + Intronic
1129390042 15:75215826-75215848 CAGCATTCCTGGGACTGGTGGGG + Intergenic
1129740565 15:77987682-77987704 CAGTCTTCCTGGGAGGTGGGTGG + Intronic
1129770639 15:78201273-78201295 CAGCCCTCCTGGGACTAGGGTGG - Intronic
1132060076 15:98685301-98685323 CATACTTCCTGGAAAGTGGGTGG + Intronic
1132302847 15:100787184-100787206 AAGACTTCATGGGACGGGGTGGG + Intergenic
1132356999 15:101179301-101179323 CAGGCGTAGTGGGACGGGGGTGG - Intronic
1132684861 16:1158089-1158111 CAGTGTTCCTGGGACAGGTGTGG + Intronic
1132687692 16:1169148-1169170 CAGTCTTCCTGCGGCGGGGTGGG + Intronic
1132714357 16:1283492-1283514 CCGGCTTCCTGGGGCGGGGGAGG - Intergenic
1132928946 16:2448800-2448822 CCCACTTCCTGGGGCAGGGGTGG - Intronic
1133031739 16:3014330-3014352 CAGGGTTCCTGGGGCAGGGGAGG - Exonic
1135052246 16:19202583-19202605 CAGACCTCCAGGGAGGGGAGGGG - Intronic
1137757880 16:50917019-50917041 CAGACTTCTTGGGAGGGCTGGGG - Intergenic
1138319238 16:56097930-56097952 GTGGCTTCCTGGGTCGGGGGTGG + Intergenic
1138560854 16:57800279-57800301 CAGTCTTACTGGGAAGGGGATGG + Intronic
1139652269 16:68368373-68368395 CAGACTTCCTGAGGCAGTGGAGG + Intronic
1142356192 16:89603351-89603373 CTGACTGCCTGGGATGGGGAGGG - Intergenic
1142533331 17:597325-597347 CAGACCTCTTGGGGTGGGGGAGG - Intronic
1142685802 17:1576372-1576394 CAGAGTTCCTGGGCCGGGCGCGG - Intronic
1143495400 17:7309299-7309321 CCTACTTCCTGGGAGTGGGGAGG - Intronic
1143512349 17:7403788-7403810 GAAGCTTCCTGGGGCGGGGGGGG - Intronic
1143850725 17:9809771-9809793 CAGACTTCCTGGGTCAAGTGGGG - Intronic
1144370237 17:14583597-14583619 CAGCCTTTCTGGGACAGGGGAGG - Intergenic
1145923161 17:28626573-28626595 CACACTTCCTGGGAAGAGAGGGG + Intronic
1146622695 17:34411842-34411864 CCAATTTCCTGGGATGGGGGTGG + Intergenic
1148215845 17:45833699-45833721 CAGCCTTCCTGGGGTGGGGCGGG - Exonic
1148863012 17:50614319-50614341 TAGACCTCCTGAGACGGGGAAGG + Intronic
1150923272 17:69505635-69505657 CAGACTTCCTGGGTAGGAAGTGG + Intronic
1151243885 17:72779495-72779517 CAGACATCCTGGGACATGAGAGG + Intronic
1151850436 17:76686675-76686697 CAGCCTCCGAGGGACGGGGGAGG + Intronic
1152109289 17:78348392-78348414 CAGAGGTCCTGGCACTGGGGAGG + Intergenic
1152258728 17:79255144-79255166 CAGACTGGCTGGGAGGGGTGTGG - Intronic
1152464697 17:80459169-80459191 CAGACATCCTGGGAGAGAGGAGG - Intergenic
1154101992 18:11484519-11484541 AAGATTTCTTGGGGCGGGGGGGG + Intergenic
1158973861 18:62692768-62692790 GAGAGTTCCTGGGATGGGAGAGG - Intergenic
1160357574 18:78241049-78241071 CAGCATTCCTGGGAGGGGGCTGG + Intergenic
1160659312 19:291002-291024 CAGACTTCCTGCTGCCGGGGCGG + Exonic
1160895171 19:1399095-1399117 CTGACTTGCTGGGATGCGGGAGG - Intronic
1161506215 19:4645113-4645135 AAGAATTCATGGGACAGGGGTGG + Intronic
1162630751 19:11925289-11925311 CAGATGTCGTGAGACGGGGGAGG + Intronic
1163155377 19:15437286-15437308 CAGGCTTCCTGGAATGGGGTGGG - Intronic
1163421421 19:17215654-17215676 CGGAGTCCCAGGGACGGGGGCGG - Intronic
1164505878 19:28860828-28860850 GAAACTTCCTGGAACAGGGGAGG + Intergenic
1164737720 19:30554085-30554107 CCGAATTCTTGGGAGGGGGGGGG - Intronic
1165246231 19:34500056-34500078 CAGAGGTCACGGGACGGGGGAGG - Intronic
1165311137 19:35030210-35030232 CAGACTCCCTGGGAAGGTGGGGG + Intergenic
1166157447 19:40924525-40924547 CAGACTTCCAGAGTCAGGGGTGG + Intergenic
1166166315 19:40991558-40991580 CAGACTTCCAGAGTCAGGGGTGG + Intronic
1166193918 19:41193977-41193999 GGGAGTTCCTGGGACTGGGGAGG + Intronic
1167093794 19:47362641-47362663 CCGAATTTCTGGGACGGGGTAGG - Exonic
1167174154 19:47853833-47853855 CAAACTTGCAGGGACTGGGGAGG + Intergenic
925277779 2:2662594-2662616 CAGACTTGCAGGGACAGGGCTGG + Intergenic
926083813 2:10008954-10008976 GAGGCTGCCTGGGATGGGGGCGG + Intergenic
927862406 2:26568352-26568374 CAGAGGTCCTGGGAAAGGGGTGG - Intronic
927876500 2:26658817-26658839 AACACTTCCTGGGGCTGGGGAGG - Intergenic
928658407 2:33476541-33476563 CTGACCTCCTGGCACGGTGGCGG + Exonic
929788954 2:45010135-45010157 CAGAGTTTCTAGGATGGGGGTGG - Intergenic
931117686 2:59182387-59182409 GAGACTTCCTGGGATGGGGCTGG + Intergenic
931429006 2:62195402-62195424 CTGGCTTCCTGAGACGGGCGTGG + Intergenic
931867395 2:66426796-66426818 CTGACTCCCTGGGTCGGGTGGGG - Intergenic
932643230 2:73472859-73472881 GAGCTTTCCTGGGACTGGGGTGG + Intronic
934298732 2:91763956-91763978 CTGACTTACTGGGTCTGGGGTGG + Intergenic
938577568 2:132618967-132618989 CAGACTTCCTGGGAGTCGGCAGG + Intronic
938830941 2:135049779-135049801 CTGACTTCCTGGGTTGAGGGTGG + Intergenic
939814876 2:146881681-146881703 TGGACTTCCTGGGTCGGGTGGGG - Intergenic
940928192 2:159392319-159392341 CAGACTTCTTGTGAAGGAGGAGG - Intronic
1169561818 20:6809548-6809570 CAGAGTTACTGGGCCGGGCGTGG - Intergenic
1169883863 20:10376260-10376282 CTGACTTCCAGGGATGGGAGAGG - Intergenic
1172118194 20:32583878-32583900 CCCCCTTCATGGGACGGGGGAGG - Intronic
1172646074 20:36470426-36470448 CAGACTCCCTGGGTTGGGAGGGG - Intronic
1172961825 20:38805622-38805644 CTGAGCTCCTGGGACTGGGGTGG - Intergenic
1172977887 20:38920125-38920147 CAGCCTTCCTGGTGCTGGGGAGG + Exonic
1174461976 20:50689713-50689735 CAGTTTACCTGGGACTGGGGGGG + Intronic
1174570962 20:51500840-51500862 CAGACTGCCTGGGAGGGTGAGGG - Intronic
1175709230 20:61206079-61206101 CTGGCTTCCTGGGGCTGGGGGGG - Intergenic
1175733654 20:61370990-61371012 GAGGCTTCCTGGGAACGGGGCGG + Intronic
1175901011 20:62359940-62359962 CGGATGCCCTGGGACGGGGGTGG - Intronic
1176457927 21:6929184-6929206 CAGGCTGCCTGGGGTGGGGGTGG + Intergenic
1176836099 21:13794268-13794290 CAGGCTGCCTGGGGTGGGGGTGG + Intergenic
1177743467 21:25181758-25181780 CAGAATTGCTGGGACCTGGGAGG + Intergenic
1178715768 21:34963085-34963107 CAGTCCTCCTGGGACAGGGCTGG + Intronic
1179478866 21:41665368-41665390 CAGACATGCTGGGACAGAGGGGG + Intergenic
1179499018 21:41795183-41795205 TAGACTTCCTGGGACAAGAGTGG + Intergenic
1179563989 21:42235019-42235041 CAGCCTCCCTGGGACAGGGGCGG + Intronic
1179996805 21:44977914-44977936 CAGGCTGCCTGGGGTGGGGGTGG + Intergenic
1180783570 22:18534931-18534953 CAGCCCTCCTGGGAGGAGGGAGG + Intergenic
1180790655 22:18573890-18573912 CAGACTGCCTGAGAGGGGTGTGG - Intergenic
1181127137 22:20708982-20709004 CAGCCCTCCTGGGAGGAGGGAGG + Intronic
1181231082 22:21421424-21421446 CAGACTGCCTGAGAGGGGTGTGG + Intronic
1181240472 22:21474283-21474305 CAGCCCTCCTGGGAGGAGGGAGG + Intergenic
1181256709 22:21567660-21567682 CGCACTTCCTGGAGCGGGGGAGG - Intronic
1181805150 22:25370095-25370117 CAGAGTTCCAGGAACGGGTGTGG - Intronic
1181852524 22:25760320-25760342 CAGAATTGCTGGAACTGGGGAGG + Intronic
1181894481 22:26094901-26094923 TGGACTTCCTGGGTCGAGGGGGG - Intergenic
1181934699 22:26429874-26429896 CATAATTCGTGGGACAGGGGAGG - Intronic
1181947495 22:26529471-26529493 CTGACCTCCTGGGAGGGGAGAGG + Intronic
1182029913 22:27150469-27150491 CAGACTTCCTGGGTTAGGAGGGG + Intergenic
1182447520 22:30398153-30398175 CAGCCTTCCTGGGATGGGGGAGG - Intronic
1183295866 22:37029261-37029283 CAGACTTCCTGAGCCAGGAGGGG + Exonic
1183613513 22:38927305-38927327 CAGGCTGCCGGGGGCGGGGGGGG + Intergenic
1183740184 22:39664724-39664746 GAGACTACCTGGGGCGGGGGTGG - Exonic
1183747670 22:39700913-39700935 CAGACTTTCTGGGGCGGGGGTGG + Intergenic
1183821041 22:40346261-40346283 AAGACTTCCTTGGCCGGGCGCGG - Intergenic
1184394924 22:44228528-44228550 CAGACTTCCTGGGATGGCAGAGG - Intergenic
1184794237 22:46722393-46722415 CAGACTTGATGGGGAGGGGGTGG + Intronic
1185163089 22:49241309-49241331 GTGACTTCCTGGGAAGGGGCCGG - Intergenic
949449342 3:4167647-4167669 CGGACTTCCTGGGTCGAGTGGGG - Intronic
950402751 3:12782610-12782632 CAAACTTTCTGGGAAAGGGGCGG + Intergenic
950422323 3:12906384-12906406 CAGCCTTCCTGGGGAGGGGCAGG - Intronic
950494040 3:13323258-13323280 CAGAGTACCTGGGAGCGGGGAGG - Intronic
951053723 3:18123390-18123412 CAGACTACCTGGAAAGGGAGTGG - Intronic
953040833 3:39253544-39253566 CAGATTTCCTGGGCAGGAGGAGG + Intergenic
953759598 3:45676150-45676172 GAGAATTCCTTGAACGGGGGAGG + Intronic
954130586 3:48558757-48558779 CAGATCTGCTGGGACTGGGGTGG - Intronic
956311706 3:67888121-67888143 CTGACTTCCTGGGTCGAGTGGGG + Intergenic
958436204 3:94098826-94098848 CTGACTTCCTAGGAGTGGGGTGG + Intronic
962349586 3:134646911-134646933 CAGAGATCCTGGGCCTGGGGTGG + Intronic
966734094 3:183175293-183175315 CAGACTTCCTCTGACAAGGGAGG - Intergenic
966852463 3:184172441-184172463 AATACTTCCTTGGACGGGTGCGG + Exonic
966881029 3:184351385-184351407 CAGACTGCCTGGGGTGGGCGAGG - Intronic
967077125 3:186013593-186013615 CAGACTCCCTGGGGGGGGAGGGG + Intergenic
968924691 4:3541040-3541062 CATAATACCTGGGAGGGGGGAGG - Intergenic
969286963 4:6208605-6208627 CAGACTTCCTGGCAGGCGTGGGG - Intergenic
969350358 4:6594736-6594758 CAGGCTTCCAGGGGCTGGGGTGG + Intronic
969392696 4:6901795-6901817 CACAATGCCTGGCACGGGGGAGG + Intergenic
969448701 4:7260382-7260404 CAACATTCCTGGGAGGGGGGAGG - Intronic
970613057 4:17743245-17743267 CAGAGTGGCTGGGATGGGGGTGG + Intronic
970657378 4:18246410-18246432 TAGACTTCCTGGGTCGAGTGGGG - Intergenic
970677317 4:18465691-18465713 GAGACCTCCTGGGAGGGGAGAGG - Intergenic
974534178 4:63153481-63153503 TAGACTTCCTGGGTCGAGTGGGG - Intergenic
980970306 4:139561022-139561044 TAGACTTTCTGGGGCGGGGAGGG + Intronic
981494650 4:145377668-145377690 CTGACTTCCTGGGAGGGCAGAGG - Intergenic
985526336 5:404540-404562 CAGGCGTCCTGGGCCGGGGCAGG + Intronic
985880726 5:2636946-2636968 CAAACGTCCTGGAATGGGGGTGG + Intergenic
986311073 5:6551600-6551622 GAGACTTCCTGGGCTGGCGGGGG - Intergenic
988619166 5:32804933-32804955 TAGACTTCCTGGGTCGAGTGGGG - Intergenic
990141618 5:52711121-52711143 CAGACTTCCTTGTAAAGGGGTGG - Intergenic
990698204 5:58446415-58446437 TGGACTTCCTGGGTCGGGTGGGG - Intergenic
994058472 5:95446972-95446994 CAGACTCTCTGGGTCTGGGGTGG - Intronic
996373167 5:122774883-122774905 CAGACTTTCTGGGAGGAGGCGGG + Intergenic
997813746 5:136996608-136996630 TAGACTTCCTGGGTCGAGTGGGG + Intronic
999167662 5:149564532-149564554 CAGACATCCTCGGCCGGGCGCGG + Intronic
999399341 5:151252767-151252789 CAGAGCTCCTGGGAAGGGCGGGG - Intronic
1004619186 6:17318550-17318572 CAAACTTCCTGGGATGGGGCTGG + Intergenic
1006134615 6:31888068-31888090 GGGACATCCTGGGACAGGGGTGG + Exonic
1006171485 6:32095870-32095892 CTGACTGCCGGGGACGTGGGCGG - Intronic
1006283334 6:33073926-33073948 CTGACTGTCTGGGATGGGGGTGG - Intronic
1006351441 6:33524188-33524210 CAAACTTCCAGGGAGGGGAGAGG + Intergenic
1016207229 6:141483869-141483891 CAGTCTTACTGGGAGGGTGGAGG + Intergenic
1017524996 6:155234723-155234745 CAGCATTCCTGGGGTGGGGGTGG + Intronic
1018051841 6:160016093-160016115 CAGACTGCTTGGGACTGGGCTGG + Intronic
1019734768 7:2645201-2645223 CACACTTCCTGTGCCGGGGGAGG - Intronic
1020091577 7:5345091-5345113 CAGACTTTGTGGGATGGTGGGGG - Intronic
1021558438 7:21945447-21945469 CAGCCCTCGTGAGACGGGGGAGG - Intronic
1021984503 7:26085692-26085714 CAGAATGCCTGGGACAGGGTGGG - Intergenic
1022715083 7:32891659-32891681 CAGCCTTCCTCGGCCGGAGGCGG - Exonic
1024480052 7:49853335-49853357 ATGACTTCCTGGGCCTGGGGAGG - Intronic
1026854252 7:73742752-73742774 CAGGCTTCCTGTGAAGTGGGAGG + Intergenic
1027035601 7:74922873-74922895 CAGCCTTCCTGGGAGGGGCTGGG + Intergenic
1028424829 7:90674777-90674799 CAGACCTCCTGGGACAGGCCAGG + Intronic
1029275504 7:99401613-99401635 CAGAAATCCTGGGCCGGGTGTGG - Intronic
1029394457 7:100298264-100298286 CAGCCTTCCTGGGAGGGGCTGGG - Intergenic
1030050471 7:105532626-105532648 CACACCTCCTGGGAAGGTGGCGG + Intronic
1030064997 7:105652684-105652706 CAGCCTTCCTGGCAGGGGGATGG - Intronic
1030091296 7:105861397-105861419 CAGGCTAGCTGGGATGGGGGTGG + Intronic
1031025124 7:116671957-116671979 CAGACTGCCTGAGCTGGGGGAGG + Intergenic
1033055735 7:138052134-138052156 CAGACTTCCTGGGTCGAGTGGGG - Intronic
1033328452 7:140398366-140398388 AAGACCTGCTGGGGCGGGGGCGG - Intronic
1034285008 7:149878776-149878798 CACAGTACCTGGGTCGGGGGCGG - Intronic
1035759077 8:2055963-2055985 CAGACGGCCTGGGAAGGAGGCGG - Intronic
1036771010 8:11578492-11578514 CAGCCTTCCTGGGACAAGGGTGG + Intergenic
1036787316 8:11696940-11696962 GAGACTTCCTGGGGGAGGGGTGG + Intronic
1040528139 8:48242216-48242238 AAGACTTCCTGGGTCGAGTGGGG + Intergenic
1041269232 8:56094438-56094460 AAGATTTCCTGGGCCGGGCGCGG - Intergenic
1044512551 8:93099076-93099098 CAGAATTCTGGGGTCGGGGGTGG + Intergenic
1047942093 8:129836209-129836231 CAAACTTTCTGGGAAAGGGGCGG + Intergenic
1048977773 8:139682545-139682567 CAGTCTGCATGGGACAGGGGTGG + Intronic
1048977849 8:139682979-139683001 CAGGCCTCCTGGGACTGGGGTGG + Intronic
1049425043 8:142534234-142534256 CAGAGATCCTGGGGAGGGGGCGG - Intronic
1049466399 8:142752899-142752921 CAGACTGCCTGGAAGGGGGCAGG + Intergenic
1049588428 8:143442386-143442408 CAGGCTTCAGGGGCCGGGGGGGG + Intronic
1049741432 8:144242891-144242913 CAGCTGTCCTGGGACGGGTGGGG - Intronic
1052655171 9:31349754-31349776 CAGACTCTCTGGGCCAGGGGAGG + Intergenic
1052903660 9:33816745-33816767 CAGCCATCCTGGGACGGGCCTGG - Intergenic
1053624956 9:39860044-39860066 CAGACTTCCTGGGTCGAGTGGGG - Intergenic
1053799763 9:41757007-41757029 CATAATACCTGGGAGGGGGGAGG - Intergenic
1053879914 9:42583184-42583206 CAGACTTCCTGGGTCGAGTGGGG + Intergenic
1053892748 9:42711127-42711149 CGGACTTCCTGGGTCGAGTGGGG - Intergenic
1054145448 9:61557927-61557949 CATAATACCTGGGAGGGGGGAGG + Intergenic
1054218941 9:62390654-62390676 CAGACTTCCTGGGTCGAGTGGGG + Intergenic
1054231776 9:62518515-62518537 CAGACTTCCTGGGTCGAGTGGGG - Intergenic
1054650343 9:67619514-67619536 CATAATACCTGGGAGGGGGGAGG + Intergenic
1054813554 9:69453956-69453978 CACACTTCCTGAGAAGGGGCTGG + Intronic
1055397298 9:75889720-75889742 CTGCCTTCCTGGAGCGGGGGTGG - Intergenic
1057023460 9:91718574-91718596 CTGCCATCCTGGGGCGGGGGGGG + Intronic
1057081252 9:92176246-92176268 CAGACTTCTTGGGGCAGGGTTGG + Intergenic
1057524484 9:95786576-95786598 CAGTCTTCCAGGGAGGGGAGTGG + Intergenic
1058432987 9:104935601-104935623 CAGACTTGCTGGAACCCGGGAGG - Intergenic
1059064622 9:111070125-111070147 AAGACTTTCTGGGCCGGGTGTGG + Intergenic
1060636010 9:125200416-125200438 CTGACTTCCTGGGCTGGCGGTGG - Intergenic
1060744802 9:126124213-126124235 CAGTCCTCCTGGGGCGGGGGGGG - Intergenic
1060875192 9:127078023-127078045 AAGGCTTCCTGGGCTGGGGGTGG - Intronic
1061280940 9:129597393-129597415 CAGCCTTCCCGGGACAGGGCCGG - Intergenic
1061940065 9:133879052-133879074 CAGGATGCCTGGGATGGGGGCGG - Intronic
1061940451 9:133881075-133881097 CAGCCTCTCTGGGACGTGGGTGG - Intronic
1062040024 9:134400293-134400315 AAGTCTTCCTGGGGCTGGGGAGG + Intronic
1062056946 9:134473716-134473738 CAGGCTTCCTGGAACAGGTGTGG - Intergenic
1062120876 9:134833511-134833533 CAGGCTTCCTGAGACAGGAGTGG - Intronic
1062137169 9:134935313-134935335 CAGCCTCCCTGGGACTGGAGGGG + Intergenic
1062527785 9:136985259-136985281 CAGCCTGTCTGGGTCGGGGGAGG + Exonic
1203568536 Un_KI270744v1:111217-111239 CTGAGTTCCTGGGAGGGGAGAGG + Intergenic
1185579298 X:1198173-1198195 CTGCCTTCCTGGGAGGTGGGAGG - Intronic
1185579319 X:1198233-1198255 CTGCCTTCCTGGGAGGTGGGAGG - Intronic
1185579331 X:1198265-1198287 CTGCCTTCCTGGGAGGTGGGAGG - Intronic
1185579343 X:1198297-1198319 CTGCCTTCCTGGGAGGTGGGAGG - Intronic
1185579384 X:1198417-1198439 CTGCCTTCCTGGGAGGTGGGAGG - Intronic
1189854610 X:45210964-45210986 CAGATTTATTGGGATGGGGGTGG - Intergenic
1190924104 X:54886246-54886268 CTGCCTTCCTGGGCCGGGGGAGG + Intergenic
1191875251 X:65788642-65788664 CAGACTGCCTGGGGGTGGGGTGG + Intergenic
1193677489 X:84473998-84474020 CAGATATCCTGGGCCGGGCGCGG + Intronic
1194156016 X:90389914-90389936 CGGACTTCCTGGGTCGAGTGGGG - Intergenic
1195815114 X:108876686-108876708 CAGACATCCTGGGCTGGGAGTGG + Intergenic
1196419856 X:115510143-115510165 TGGACTTCCTGGGTCGGGTGGGG + Intergenic
1199738533 X:150709340-150709362 CAGTGTTCCTGGTATGGGGGTGG - Intronic
1199746657 X:150776039-150776061 CAGACTTCCTGGGACGGGGGTGG - Intronic
1199881158 X:151974904-151974926 CAGACAGCCAGGGGCGGGGGAGG + Intergenic
1201258501 Y:12134226-12134248 TAGACTTCCTGGGTCGAGTGGGG + Intergenic
1201648433 Y:16260953-16260975 TGGACTTCCTGGGTCGGGTGGGG - Intergenic
1201654377 Y:16324348-16324370 TGGACTTCCTGGGTCGGGTGGGG + Intergenic