ID: 1199748275

View in Genome Browser
Species Human (GRCh38)
Location X:150790175-150790197
Sequence CGCTAATAGAAACTAGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199748272_1199748275 6 Left 1199748272 X:150790146-150790168 CCACAGAGAAGTAAACAAATCAG 0: 1
1: 0
2: 1
3: 40
4: 394
Right 1199748275 X:150790175-150790197 CGCTAATAGAAACTAGACTAGGG 0: 1
1: 0
2: 0
3: 2
4: 54
1199748271_1199748275 22 Left 1199748271 X:150790130-150790152 CCTGGATAAGGTAAAACCACAGA 0: 1
1: 0
2: 3
3: 20
4: 198
Right 1199748275 X:150790175-150790197 CGCTAATAGAAACTAGACTAGGG 0: 1
1: 0
2: 0
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199748275 Original CRISPR CGCTAATAGAAACTAGACTA GGG Intronic
1066568581 10:36747109-36747131 TGCTAAAAGAAACTAGGCTCTGG - Intergenic
1066967838 10:42285904-42285926 CGCTAATAGAAAGAGGACCATGG - Intergenic
1071145915 10:82571253-82571275 GGCCAATAGAAACTAGACAAGGG + Intronic
1073162528 10:101411492-101411514 CACTAAGAGAAAAAAGACTAAGG - Intronic
1074551340 10:114445133-114445155 TGTTAATAGTAACTAGAATATGG - Intronic
1075475690 10:122731568-122731590 CTGGAAAAGAAACTAGACTAAGG - Intergenic
1079141476 11:17813047-17813069 CCCTAAAACAAGCTAGACTAAGG + Intronic
1101207073 12:102499225-102499247 CGCTAATATACCCTAGACTTTGG + Intergenic
1108637826 13:52352992-52353014 AGCTAAAAGAAATTAGGCTAAGG + Intergenic
1113052831 13:106233719-106233741 GGCTAATTGAAACTTGAGTAAGG + Intergenic
1113215273 13:108032979-108033001 CGCAGATAGAAAGTAGAATAGGG - Intergenic
1116779294 14:49218492-49218514 CGCTACTAGAATTTAAACTACGG + Intergenic
1120242265 14:81963173-81963195 CCCAAATAGAAAATAGCCTAAGG - Intergenic
1120415556 14:84214811-84214833 CAATAGTAGAAACTAGAGTAGGG - Intergenic
1121872644 14:97423371-97423393 TATTAATAGAAACTAGACTTTGG - Intergenic
1126630568 15:50730361-50730383 CGTCAAGAGAAACTAGACTCAGG - Intronic
1129581570 15:76817039-76817061 TGCTGATAGAAACAAGCCTATGG - Intronic
1133098272 16:3462737-3462759 CACTAATAGTAATTATACTAGGG + Intronic
1134325710 16:13205674-13205696 GGCTACTAGAAACAAGACCAGGG - Intronic
1136733935 16:32445412-32445434 CGCTAATAGAAAGAGGACCATGG - Intergenic
1203019148 16_KI270728v1_random:384187-384209 CGCTAATAGAAAGAGGACCATGG + Intergenic
1203037483 16_KI270728v1_random:657345-657367 CGCTAATAGAAAGAGGACCATGG + Intergenic
1142702487 17:1672247-1672269 CTCTAATGGAAACCAGAGTAAGG + Intronic
1147730636 17:42599015-42599037 CACAAATAGAAACTAGGGTAGGG - Intronic
1150237773 17:63606897-63606919 TGCTAGTAGAAACTACATTAAGG - Intronic
1163046765 19:14648726-14648748 CCTCAAGAGAAACTAGACTAAGG + Intronic
1167843976 19:52145269-52145291 AGTAAATAGAAACTAGACTGTGG - Intergenic
933156152 2:78978007-78978029 GAATTATAGAAACTAGACTATGG + Intergenic
935617827 2:105103691-105103713 CTGTAATAGGAACTAGACTGTGG + Intergenic
939713818 2:145557920-145557942 CTCTAATTGAACCTTGACTAGGG - Intergenic
945718149 2:213384103-213384125 TTATTATAGAAACTAGACTAGGG + Intronic
1171943436 20:31353382-31353404 CCCTAAGAGAAACAAGACTGAGG + Intergenic
950062257 3:10081724-10081746 TGCTAAAGGAAACTGGACTAAGG - Intronic
953621971 3:44541309-44541331 CTCTAGTAGAAACTACTCTATGG - Intergenic
957667911 3:83259920-83259942 AGCCAATAAAAACTATACTATGG + Intergenic
957963221 3:87287987-87288009 AGCTAATAGATACTTGACAAAGG + Intergenic
971924897 4:32995918-32995940 CACTAATACACACTAGACTGAGG - Intergenic
975602930 4:76122017-76122039 CGCATTTAGAAACTAGACAACGG - Intronic
976235902 4:82896657-82896679 AGCTAATTGGAACTAGAGTATGG + Intronic
976324919 4:83760435-83760457 CCCTAATATAAAATAGAATAAGG - Intergenic
980521577 4:133943063-133943085 GACTAATAGAAACAAGATTAGGG - Intergenic
980753687 4:137127444-137127466 TTCTAAAAGAAAGTAGACTAAGG + Intergenic
994256710 5:97605460-97605482 CGCAAATAGAAACCACAGTAAGG + Intergenic
994993874 5:107034765-107034787 CCCAAATAGAACCTAGAATAGGG + Intergenic
999941109 5:156544130-156544152 TGCTAATATCACCTAGACTAAGG - Intronic
1008431787 6:51426742-51426764 TGGTAATAGAAACTAAAATATGG - Intergenic
1012175929 6:96084617-96084639 GTCTCATAGAAATTAGACTAAGG + Intronic
1016694240 6:146974266-146974288 CTCTAAGAGGAACTTGACTAGGG - Intergenic
1021459870 7:20874210-20874232 TGCTAATAGAATCCAGACTGTGG + Intergenic
1031037661 7:116805774-116805796 ACCTAATAGAAACTGGACCAGGG + Intergenic
1037349445 8:17934963-17934985 CACTAATACAAATTAAACTAGGG + Intronic
1048374961 8:133815199-133815221 CTAATATAGAAACTAGACTATGG + Intergenic
1057812716 9:98270176-98270198 CCCCAATAGAAACTTGACAATGG - Intergenic
1058559545 9:106211394-106211416 CACTAATAAAAAATAGACTAGGG - Intergenic
1188890912 X:35610444-35610466 CCCTAATACAAACTCGACAATGG + Intergenic
1199748275 X:150790175-150790197 CGCTAATAGAAACTAGACTAGGG + Intronic
1201326501 Y:12765980-12766002 AGCTAATAGACACTACACCAAGG - Intronic