ID: 1199748290

View in Genome Browser
Species Human (GRCh38)
Location X:150790263-150790285
Sequence TGTTCTGTATGGTACTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199748286_1199748290 -4 Left 1199748286 X:150790244-150790266 CCTTGCATGGTGAAGAAACTGTT 0: 1
1: 0
2: 2
3: 17
4: 272
Right 1199748290 X:150790263-150790285 TGTTCTGTATGGTACTTGGGTGG 0: 1
1: 0
2: 4
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199748290 Original CRISPR TGTTCTGTATGGTACTTGGG TGG Intronic
900766012 1:4505944-4505966 TGTTCTGTATTTTCCTGGGGAGG - Intergenic
900882294 1:5390889-5390911 GGTTCTGACTGGTACTGGGGTGG + Intergenic
902864848 1:19271122-19271144 TGTTATCTCTGCTACTTGGGAGG + Intergenic
903752760 1:25637520-25637542 TGTATTGTATGGTTGTTGGGTGG + Intronic
904812701 1:33173819-33173841 TGTAGTGTGAGGTACTTGGGAGG - Intronic
906755039 1:48303863-48303885 TGTTCTGTTTGTTTCTTTGGGGG + Intronic
907784154 1:57595636-57595658 TATTCTATATGGGATTTGGGGGG - Intronic
909597173 1:77419391-77419413 TGTTCTTTCTAGTTCTTGGGGGG - Intronic
909780999 1:79547283-79547305 TGTTCTATATGTTACTGTGGAGG + Intergenic
910765973 1:90782677-90782699 TGTTATCTAAGCTACTTGGGAGG - Intergenic
915706683 1:157850689-157850711 TGGTCTCTTTGGTGCTTGGGTGG + Intronic
916569940 1:166016456-166016478 TCTTCTGAATGCTACTTGGATGG - Intergenic
917035029 1:170739206-170739228 TGATTTGTAGGGTACTTGGCAGG + Exonic
917064127 1:171073475-171073497 TGTTCTGATTGGCAATTGGGTGG - Intergenic
917582195 1:176390627-176390649 TGTACTGCCAGGTACTTGGGAGG - Intergenic
920323694 1:205144460-205144482 TGTATTGTATATTACTTGGGAGG - Exonic
921109324 1:212017271-212017293 TGGGCTGTTTGGTACCTGGGAGG - Intronic
921428586 1:215035352-215035374 TATTCTGTATGGCACTGGGATGG - Intronic
923363884 1:233240196-233240218 TCGTCTCTTTGGTACTTGGGTGG - Intronic
1066670241 10:37829460-37829482 TGTTCTATATGGTAATTAGGGGG - Exonic
1067471148 10:46539185-46539207 TATTCTGTATGCTACTGGAGTGG + Intergenic
1067674184 10:48356250-48356272 GTTTCTGTAAGGTACTTGTGAGG + Intronic
1070219015 10:74420945-74420967 TGTTCTGTATGGTACTGTGGTGG + Intronic
1070431730 10:76346877-76346899 TGTTGTGTATTGTATTGGGGAGG - Intronic
1073539982 10:104310271-104310293 TGTGCTGTAGGGTACATGGCCGG - Exonic
1074879150 10:117639019-117639041 TGTTCTGTATGGTAATAGGGTGG - Intergenic
1074894793 10:117765939-117765961 TGTACTTTATGGGAGTTGGGAGG + Intergenic
1077275256 11:1702752-1702774 TGTAATGTAAGCTACTTGGGAGG + Intergenic
1077286920 11:1771014-1771036 TGTTGTGTATGGTATGAGGGAGG - Intergenic
1080320003 11:30997240-30997262 TGTTCTTTATGATACTGGAGTGG + Intronic
1081626580 11:44659618-44659640 TGTTCTGTCTCCTCCTTGGGTGG + Intergenic
1082644644 11:55706786-55706808 TGATCTGAATGGTTTTTGGGAGG + Intergenic
1084662549 11:70554725-70554747 TCTTCTGTATGGCACTGGAGTGG - Intronic
1084891428 11:72238840-72238862 TGTTCTGTGTGGGTCTGGGGAGG + Exonic
1085441694 11:76569916-76569938 TATTCTGTATGGTTCTGGAGTGG - Intergenic
1091812548 12:3411524-3411546 TGTGCTGTATGGTACTAGCTTGG + Intronic
1096811735 12:54174843-54174865 TGTTCTGTTTTGTACTTGAGAGG + Intronic
1098149568 12:67532425-67532447 TTTTCAGTATGATATTTGGGGGG - Intergenic
1098219797 12:68257093-68257115 TGGTCTGTCTGGGACCTGGGAGG - Intergenic
1106176891 13:27339504-27339526 TGTTCTGTTTGGTGCATGGTGGG + Intergenic
1108527896 13:51301341-51301363 TCTTCTGTAAGGTACTACGGTGG - Intergenic
1108896938 13:55342172-55342194 TGTTCTATTTAGTCCTTGGGTGG + Intergenic
1110848966 13:80222782-80222804 TCATATGTATGGTACTTGGTAGG - Intergenic
1111456605 13:88492619-88492641 TGTTCCGTAGGGTATTTGGACGG - Intergenic
1111756709 13:92405919-92405941 TGTTCTCTCTGATACTTGGAAGG - Intronic
1112243078 13:97701727-97701749 TGTTCTGTAGAGCACCTGGGTGG + Intergenic
1114169085 14:20253592-20253614 TATTTTTTATGGTACTGGGGTGG + Intergenic
1115214524 14:31001767-31001789 TGTTATGAATGGCCCTTGGGAGG + Intronic
1116479963 14:45385587-45385609 TGCTCTGTATGCTTCTCGGGAGG - Intergenic
1119794806 14:77386253-77386275 TGTTCTGTATGGTTCTTTGGTGG - Intronic
1120720639 14:87886742-87886764 TGTTCTGCATGATGCTTTGGTGG - Intronic
1121405299 14:93716014-93716036 TGTTCAGTGTGGTACCTGGCTGG + Intergenic
1121896312 14:97651302-97651324 TGTGCTGTATAATCCTTGGGGGG + Intergenic
1126653940 15:50955909-50955931 TTTTCTGTGTGGTATTTGGCTGG + Intronic
1128626222 15:69207341-69207363 TGTTCTGTATGACACTGAGGTGG - Intronic
1130118085 15:81023017-81023039 TGTAATCTAAGGTACTTGGGAGG + Intronic
1130541645 15:84824583-84824605 TGTTCTGTGTGGCTCATGGGTGG + Intronic
1135045649 16:19152965-19152987 TATTCTTTGTGGGACTTGGGTGG - Intronic
1136138583 16:28274110-28274132 TATTCTGTATGATACTGGGAGGG + Intergenic
1139120252 16:64007657-64007679 TGCTCTGTGTGGTGCTGGGGTGG - Intergenic
1144110213 17:12023289-12023311 TGTTCTGTATCTTAATTGTGAGG + Intronic
1145848696 17:28069008-28069030 TGTTCTGTATCTTGATTGGGTGG - Intronic
1147582091 17:41632763-41632785 TGTGGTGTGTGGTACATGGGTGG + Intergenic
1148150569 17:45394523-45394545 TGTTCTGTCTGGACCTGGGGAGG - Exonic
1149735958 17:58993690-58993712 TGTTCTGTATAGTATTGTGGTGG + Intronic
1152728414 17:81958805-81958827 TGTTCTGGATGGTTCTTTTGGGG - Intronic
1152886486 17:82854069-82854091 TGTGCTGTGTGTTACTTGGAGGG - Intronic
1153930373 18:9873474-9873496 TATTCTGTATGGTACTGTAGTGG + Intergenic
1156648216 18:39193424-39193446 TGTTCTGGATGTTTCTTGGAGGG - Intergenic
1159602791 18:70444792-70444814 TGTGGTGTCTGCTACTTGGGAGG - Intergenic
1159728351 18:71992579-71992601 TGCTCAGTATGGTGCTGGGGTGG + Intergenic
1159737074 18:72113355-72113377 TGTAGTTCATGGTACTTGGGAGG + Intergenic
1163891213 19:20016187-20016209 TGTACTGTCAGCTACTTGGGGGG + Intronic
1164856154 19:31525541-31525563 TATTCTGTATGGTTCTTGGGTGG - Intergenic
928011307 2:27610240-27610262 TGTACTCTAAGCTACTTGGGAGG + Intronic
929922707 2:46183957-46183979 TGTGCCTTATGGTTCTTGGGGGG - Intronic
931295703 2:60922920-60922942 TGTACTGTCAGCTACTTGGGAGG + Exonic
932400329 2:71476088-71476110 TGTTGTACATGGAACTTGGGGGG + Intronic
934845957 2:97661424-97661446 TGCCCTGTATGGTACTGGTGGGG - Intronic
935113035 2:100109156-100109178 TGTTTTGTTTGGTACTTGAAGGG - Intronic
936122598 2:109759957-109759979 TGTTTTGTTTGGTACTTGAAGGG + Intergenic
936222096 2:110611515-110611537 TGTTTTGTTTGGTACTTGAAGGG - Intergenic
939941203 2:148353700-148353722 TGTAGTCTAAGGTACTTGGGAGG - Intronic
940693060 2:156944186-156944208 TGTACTGTATAGTAGTTGAGAGG - Intergenic
941031209 2:160513706-160513728 TGTTCTGTATCGTGATTGCGAGG - Intergenic
941596085 2:167478940-167478962 TGGATTGTATGCTACTTGGGAGG + Intergenic
941843451 2:170111389-170111411 TTTTCTGAATTGGACTTGGGAGG + Intergenic
942096530 2:172539545-172539567 TGTAATGTAAGCTACTTGGGAGG + Intergenic
942705655 2:178769074-178769096 TGTCCTGTATAGTACATGGAAGG - Intronic
944089705 2:195892749-195892771 TGTTCTGTATGGTACTATAATGG - Intronic
946393725 2:219432489-219432511 TGCTCTGTATGGTCCTGGAGTGG + Intergenic
948743698 2:240069292-240069314 TGTTCTTAATGGTACTTAGATGG - Intergenic
1170272629 20:14545261-14545283 TATCCTGTCTGGTACCTGGGTGG + Intronic
1171344337 20:24454076-24454098 TGCTCTGTTTGCTTCTTGGGAGG + Intergenic
1172670022 20:36628665-36628687 TGTTGTCTAAGCTACTTGGGAGG - Intronic
1175458166 20:59130759-59130781 TATTCTGAATGGTTCTTGGGTGG + Intergenic
1179295550 21:40059085-40059107 TGTTCTGTGTCATATTTGGGAGG - Intronic
1180296282 22:10938950-10938972 TGATCTGGATAGTACTTAGGAGG + Intergenic
1185152682 22:49174544-49174566 TGTTCTGTGTTTTAATTGGGTGG - Intergenic
949833434 3:8242072-8242094 TGTTCTGTATGGTACTATAATGG + Intergenic
951711868 3:25591641-25591663 TGTTTAGTATGGTACCTGGTAGG + Intronic
952002502 3:28802603-28802625 TGTTCTTTGTGGTTCTGGGGAGG + Intergenic
954751444 3:52816453-52816475 TGTCCTGTGGGGTGCTTGGGGGG + Intronic
954761124 3:52875082-52875104 TGTTATCTATGGTAGATGGGAGG + Intronic
956305847 3:67824607-67824629 TTTTCTGTATTGTATTTTGGAGG + Intergenic
956644807 3:71445119-71445141 TGTTCTCCATGGTACCTGTGAGG + Intronic
957345940 3:78961850-78961872 TGTTGTATGTGGTAGTTGGGAGG + Intronic
959564461 3:107820269-107820291 TGTTCTGTATGATACTATGATGG + Intergenic
960313461 3:116146221-116146243 TGTTTTATAGGGTACTTGGGTGG - Intronic
961791165 3:129377988-129378010 TATGCTGATTGGTACTTGGGTGG + Intergenic
965456321 3:168905367-168905389 TATTCTGTATTGTACTTGATTGG + Intergenic
968288831 3:197523716-197523738 TGTGCTGTATGGAACCTGGCGGG + Intronic
970621863 4:17830269-17830291 TGTGCTGTCAGCTACTTGGGAGG + Intronic
971537273 4:27769268-27769290 TATTCTGTATGATACTATGGTGG - Intergenic
971596050 4:28530352-28530374 TGTTCTGTCTGTAACTTGGAAGG - Intergenic
971994501 4:33947765-33947787 TATTCTGTATGATACTGGAGTGG + Intergenic
973927607 4:55755306-55755328 TGTTCCTTATGGTACAAGGGTGG + Intergenic
973983634 4:56328121-56328143 TGTTCTGAATGGTGTGTGGGTGG - Exonic
976447423 4:85147509-85147531 TGTTCTGTGTTGTTCTAGGGAGG - Intergenic
979001830 4:115230783-115230805 TGTAGTCTTTGGTACTTGGGAGG + Intergenic
979639223 4:122993105-122993127 TGTACTCTAAGCTACTTGGGAGG - Intronic
980274412 4:130630952-130630974 TGATCTGTATGGTACTGCAGTGG + Intergenic
982636036 4:157897919-157897941 TGTTCTGTCTTGTATTTGTGGGG + Intergenic
985921953 5:2984353-2984375 TGTTCTGCATGGACCATGGGTGG + Intergenic
987802135 5:22712848-22712870 AGTTCTGTATGGTATTGGAGAGG - Intronic
990780297 5:59353444-59353466 TCTTCTCTATAATACTTGGGAGG + Intronic
993173365 5:84450511-84450533 TGCTCTTTAAGGTATTTGGGGGG + Intergenic
994529549 5:100951863-100951885 TGTTCTAGATGTTACTTGGGAGG + Intergenic
994894508 5:105685404-105685426 TATTATGTATGGTACTAGGTGGG - Intergenic
995599057 5:113776277-113776299 TGGTCTGTGTGGTGCATGGGGGG - Intergenic
995705899 5:114989407-114989429 TGTTTTTTATCGTACTAGGGAGG - Intergenic
996243674 5:121233226-121233248 TATTCTGTATGGTACTGTGATGG + Intergenic
996445016 5:123537773-123537795 TGTTCTATATCTTAATTGGGAGG - Intronic
996496809 5:124167567-124167589 TGTTCTATATCTTATTTGGGTGG - Intergenic
996943919 5:129043671-129043693 TGTTCTCTGTGGTCCTGGGGAGG - Intergenic
999564681 5:152844499-152844521 TATTCTGTATGGTACTCTGATGG - Intergenic
999732780 5:154487729-154487751 TGTTCTGTTTGGTACAAGGTGGG - Intergenic
999940744 5:156539971-156539993 TGTTCTGTATGGTGCTCAGAAGG - Intronic
1001359941 5:171073093-171073115 TGTTCTGTGTGGTAATGGGATGG + Intronic
1003912208 6:10752836-10752858 GGTCCTGCATGGTACTTGGATGG - Intronic
1004568912 6:16825935-16825957 TGTTCTGTAAAATCCTTGGGAGG + Intergenic
1005283515 6:24300258-24300280 TGTGGTGCATGCTACTTGGGAGG + Intronic
1010034684 6:71311351-71311373 TCTTCTGTATAGTACAGGGGTGG - Intergenic
1010688638 6:78881421-78881443 TATTCTTTATGGTACTGGAGTGG + Intronic
1017338822 6:153295755-153295777 TGTCCTGTATGATCCTTGTGTGG + Intergenic
1017740795 6:157404983-157405005 TGTTCTGAATGGGACCTGGGAGG - Intronic
1018490706 6:164289854-164289876 TGTTATGTATGTTATTTGTGGGG - Intergenic
1021061359 7:16116900-16116922 TGCTTTGTATGGTACCTGGGCGG - Intronic
1023470904 7:40518050-40518072 TCTTCTATATGGTACTGTGGTGG + Intronic
1024659232 7:51477295-51477317 TGGTGTGTATGGTACGTGTGTGG + Intergenic
1025843985 7:65179092-65179114 TGTTCTCTCAGCTACTTGGGAGG - Intergenic
1025894317 7:65685402-65685424 TGTTCTCTCAGCTACTTGGGAGG - Intergenic
1028194013 7:87884268-87884290 TGTACTCTCAGGTACTTGGGAGG + Intronic
1030812433 7:113990215-113990237 GATTCTGTCTGGTACCTGGGTGG - Intronic
1033756655 7:144402187-144402209 TGTGCTGGATGGTAGTGGGGTGG - Intronic
1037475913 8:19257611-19257633 TATTCTGTATGATACTTTAGTGG + Intergenic
1038467916 8:27783076-27783098 TGTTCTGTATGGTACTGTAATGG - Intronic
1038978663 8:32731139-32731161 TGTTTTGTATTGGACGTGGGAGG - Intronic
1040349846 8:46553549-46553571 TGTACTGTCAGCTACTTGGGAGG + Intergenic
1040707505 8:50147135-50147157 TCTTCTGCATGATACTTGGGTGG + Intronic
1043218117 8:77621309-77621331 TGTGCTGTGTGGTCCCTGGGTGG + Intergenic
1044142713 8:88674702-88674724 TCTTCTTTATAGTAATTGGGAGG + Intergenic
1045284860 8:100781703-100781725 TGTAGTGTGTGCTACTTGGGAGG + Intergenic
1050970512 9:11866362-11866384 TGTTCAGTATTGTAGTTGGAGGG + Intergenic
1051245801 9:15109532-15109554 TGTTCTGAATGGTACTGCTGTGG - Intergenic
1052912805 9:33898876-33898898 TGTTCTGTATTGCACATGGTGGG + Intronic
1054674652 9:67843960-67843982 TGTTCCGTATGGTTTTTGAGTGG + Intergenic
1055560001 9:77513249-77513271 TGTTCTGTATGCTTCTTGATGGG - Intronic
1056998475 9:91485841-91485863 TGTGATGCATGATACTTGGGTGG + Intergenic
1058192385 9:101934604-101934626 TGTTTTGTATGGTATATGGTGGG + Intergenic
1059753905 9:117274435-117274457 TAATCTGTAGGGTTCTTGGGAGG + Intronic
1060561832 9:124551829-124551851 TGTTCTGTATGGACCTGTGGTGG - Intronic
1186037542 X:5441096-5441118 TATTCTGTATGGTACTAAGATGG + Intergenic
1189844924 X:45127250-45127272 TGTCCTATATGGTACTAGGATGG - Intergenic
1191690114 X:63930806-63930828 TGTTATGAATGGTACTAGGCTGG + Intergenic
1191986519 X:66987388-66987410 TGTTCTGAGAGGTACTTGGTTGG - Intergenic
1192509770 X:71714881-71714903 CGTTCTGTACGGTACTGGGATGG - Intronic
1192516927 X:71766672-71766694 CGTTCTGTACGGTACTGGGATGG + Intronic
1192835612 X:74795591-74795613 TCTTCTGTATGGTATTGGGGTGG + Intronic
1193254944 X:79337155-79337177 TGTTCTGTAGGCTTCTTGAGTGG + Intergenic
1193398298 X:81012182-81012204 TGTTAAGTAAGGTACTTGGTGGG + Intergenic
1194223131 X:91222139-91222161 TGTTTTGCATGGTACTTTGGTGG + Intergenic
1194507344 X:94749169-94749191 TGTTCAGAATGGTATTTGTGAGG + Intergenic
1194822026 X:98521476-98521498 TGTTCTCTATGGTATTTGTTTGG + Intergenic
1196609257 X:117692512-117692534 TATTCTGTATGGTACTACAGTGG - Intergenic
1198139947 X:133792522-133792544 CCTTCTCTCTGGTACTTGGGAGG - Intronic
1198960426 X:142176278-142176300 TGGTCAGTATGATACTTGGTTGG - Intergenic
1198962458 X:142196499-142196521 TGGTCAGTATGATACTTGGGAGG - Intergenic
1198963661 X:142206337-142206359 TGGTCAGTATGATACTTGGTTGG - Intergenic
1198964989 X:142217959-142217981 TGTTTTGTATGATTCTTGGGTGG - Intergenic
1199748290 X:150790263-150790285 TGTTCTGTATGGTACTTGGGTGG + Intronic
1200274842 X:154722205-154722227 TGATCTGTTTTGTACGTGGGGGG + Intronic
1200559613 Y:4685557-4685579 TGTTTTGCATGGTACTTTGGTGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic