ID: 1199748991

View in Genome Browser
Species Human (GRCh38)
Location X:150796602-150796624
Sequence AAAATCTACAAGGATATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 423}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199748989_1199748991 10 Left 1199748989 X:150796569-150796591 CCACTCTCAGCAATTGGTAGAAC 0: 1
1: 5
2: 53
3: 160
4: 482
Right 1199748991 X:150796602-150796624 AAAATCTACAAGGATATTGAAGG 0: 1
1: 0
2: 3
3: 53
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199748991 Original CRISPR AAAATCTACAAGGATATTGA AGG Intronic
902319209 1:15648450-15648472 AAAATCTACCAGGATTTTGATGG - Intronic
906084874 1:43123066-43123088 AAAATCTACAGAAATATTAATGG - Intergenic
906572666 1:46857584-46857606 AAAATATTCAAGGAAGTTGATGG + Intergenic
906599109 1:47108307-47108329 AAAATATTCAAGGAAGTTGACGG - Intronic
907694558 1:56709698-56709720 AAAATCCACAAAAATTTTGAAGG + Exonic
907748354 1:57237668-57237690 GAAACTTACAAGGCTATTGATGG - Intronic
908502306 1:64756294-64756316 GTAATCTATAAGGATTTTGAGGG + Intronic
908608623 1:65829404-65829426 AAAATCGTTAAGGATATAGATGG + Intronic
909138200 1:71829087-71829109 AAAATCACAAAGTATATTGAAGG - Intronic
909314164 1:74195007-74195029 AAAATCTACAAAAATACTAAGGG + Intronic
909914548 1:81301165-81301187 AGAATCTAAAAGGATCTTGCTGG - Intergenic
910052124 1:82987161-82987183 CAAATCTACAAGGCTAGTAAAGG - Intergenic
910295292 1:85637907-85637929 AAAAGATACAAGGATCATGAAGG + Intergenic
910511435 1:88010749-88010771 AAAATATAAAAGGATTTTCATGG - Intergenic
910739590 1:90500443-90500465 AAAATTGACAAGTGTATTGAAGG - Intergenic
910940881 1:92532384-92532406 AAAATGAACAAGGATATCCAGGG + Intronic
911001225 1:93168523-93168545 AAAATCTTCAGGGATAAAGAGGG + Intronic
911310481 1:96286868-96286890 AAAATTAACAAAGATATTCAGGG - Intergenic
911769625 1:101723955-101723977 AGAATCTACTAAGATTTTGAGGG + Intergenic
911901466 1:103511341-103511363 AATATTGACAAGGATATTCAGGG + Intergenic
911938319 1:104009727-104009749 AAAATTAAAAAGGATATTCAGGG - Intergenic
911949794 1:104157765-104157787 GAAATCACCAAAGATATTGAAGG - Intergenic
912484045 1:110010181-110010203 AAAGTCTTCAAAGATCTTGACGG + Intronic
912731727 1:112112854-112112876 AAAAACTACAAGGACAGTCAAGG - Intergenic
915853875 1:159359702-159359724 CAAATCTACGTGGATACTGAAGG + Intergenic
916699623 1:167277962-167277984 AAATTTAACAAGGATATGGAGGG - Intronic
917233951 1:172870357-172870379 AAAATCACCCAAGATATTGATGG + Intergenic
917315754 1:173723497-173723519 AAAATCTATAAGGACATTCTAGG - Intronic
919045337 1:192444076-192444098 AAAATCTACATAGATTGTGAAGG + Intergenic
919181658 1:194091877-194091899 AAACTCTACAAAGATTCTGAAGG - Intergenic
919299919 1:195747856-195747878 ATAATCTCTAATGATATTGAAGG + Intergenic
920711976 1:208303772-208303794 AAAATGTACAAGGGAATTGGAGG - Intergenic
921272545 1:213485441-213485463 AAATGCTGAAAGGATATTGATGG + Intergenic
921657706 1:217760322-217760344 AAAATATACAATTTTATTGAAGG + Intronic
921667583 1:217891135-217891157 AAAATCAACCAGAATATTGGGGG + Intergenic
922643821 1:227264497-227264519 AAAACCTCAAAGGATATTGTAGG - Intronic
922653633 1:227362309-227362331 AAAATATACAATAATATTGTTGG + Intergenic
923481441 1:234388892-234388914 AAAATCAACCAGGATATAGGGGG + Intergenic
924485241 1:244476420-244476442 AAAATCTACCACTATATTTATGG + Intronic
924533397 1:244912825-244912847 AAAATCCAAAAGGATTTTGCTGG - Intergenic
924565194 1:245191513-245191535 AAAATCTAGAAGGAAATATATGG + Intronic
924613901 1:245596679-245596701 AAAATTAATAAGGATATTCAGGG - Intronic
1063135342 10:3211732-3211754 AAAATCTAAAATGATAATAATGG - Intergenic
1063895267 10:10674275-10674297 AAAATTATCAAGGATAATGAAGG - Intergenic
1064033375 10:11897106-11897128 AAATTCTACAAGGACCATGAAGG - Intergenic
1068126572 10:52848798-52848820 AAAATTAACAAGGATATTCAGGG - Intergenic
1068325213 10:55476240-55476262 AAAATCTACAAGCATTTTGTGGG - Intronic
1068908089 10:62349439-62349461 AAAATATACAAATATATAGATGG - Intergenic
1069060387 10:63888647-63888669 AAAATCTTCAAGGATCTTATAGG + Intergenic
1069648253 10:70020486-70020508 AAAATCTCCAGGGAAATAGATGG + Intergenic
1070889841 10:79934986-79935008 AAAATCTCCTATGATGTTGAAGG - Intergenic
1071065267 10:81626004-81626026 GAAATCAATAAGGATATAGAAGG - Intergenic
1071431426 10:85609963-85609985 GAAATCTACATGAATATTAAGGG + Intronic
1071742900 10:88381101-88381123 AAAATCTGCAAAGATATTTCTGG - Intronic
1071828122 10:89345776-89345798 AAAATCAACAGAGATATTCAGGG + Intronic
1072998025 10:100263762-100263784 AAAATCAACAAGGCTTGTGATGG - Intronic
1073171246 10:101510616-101510638 AAAACTTACAAGGATTTTGAGGG - Intronic
1073345317 10:102778469-102778491 AAACTCTTCAAGGAGAGTGAAGG + Intronic
1073526345 10:104185852-104185874 AAACTCTGAAAAGATATTGAAGG - Intronic
1073667034 10:105545179-105545201 AATAAATACAAAGATATTGAAGG - Intergenic
1073864146 10:107783153-107783175 AAAATTAAGAAGGATAATGAAGG - Intergenic
1073868832 10:107837656-107837678 AAAATCTACAAGGATACGGAGGG + Intergenic
1074209047 10:111311483-111311505 AAAATAGACAGGGATATTTATGG + Intergenic
1074321398 10:112406514-112406536 AACATCTACATTGATATTTAAGG + Intronic
1074940183 10:118228454-118228476 AAAATCAAAATGGATTTTGAGGG + Intergenic
1076308413 10:129482446-129482468 AAATTCAATAAGGATATAGAAGG - Intronic
1078167600 11:8901988-8902010 AAAATCAGCAAAGATATAGAAGG - Intronic
1080877019 11:36284481-36284503 ATATTCAACAAGGATATAGAAGG + Intronic
1081035427 11:38138257-38138279 AAAATCTCCAAATAGATTGAGGG + Intergenic
1083038446 11:59662975-59662997 AAAATCTAAAATGATGATGATGG - Intronic
1085722854 11:78928475-78928497 AAAATCTGCAAGGTGCTTGACGG + Intronic
1086422197 11:86647856-86647878 AAAATCAACAAGGATATTTCAGG + Intronic
1086669968 11:89534336-89534358 AATGTCTACAAGGATATTCAGGG - Intergenic
1087194760 11:95294154-95294176 AAAATATACAATTATCTTGAGGG + Intergenic
1087571374 11:99930897-99930919 AGACAATACAAGGATATTGAAGG + Intronic
1087994295 11:104784372-104784394 AAAATCCACAAGGGTCATGATGG + Intergenic
1088041341 11:105386698-105386720 AAAATCACCAAGAATATCGAAGG + Intergenic
1088243092 11:107790905-107790927 AAAATCCACAAGGGTTTTGAAGG + Intergenic
1088409463 11:109517821-109517843 AAAATTTATAAGGGTATTCAAGG + Intergenic
1088723575 11:112615307-112615329 AAAATCTAAAAGAATGTTCAAGG - Intergenic
1088948980 11:114546017-114546039 AAAATCAATAAGGAGATTGAGGG + Intronic
1089111145 11:116057671-116057693 AATATCAGCAAGGATATAGATGG - Intergenic
1090775634 11:129962767-129962789 AATATATACAAAGATATTCAGGG + Intronic
1090995488 11:131862075-131862097 TAAATCTACAAGGATCTTTGTGG + Intronic
1091481156 12:832494-832516 ATATACAACAAGGATATTGAAGG - Intronic
1092572073 12:9736409-9736431 AAAATTTACATGTGTATTGATGG + Intergenic
1092938781 12:13388044-13388066 AAATTCCACCAGGTTATTGAAGG + Intergenic
1093413403 12:18893765-18893787 AAAATTAACAAGGTTATTCAGGG - Intergenic
1093826803 12:23701744-23701766 ACAAACTACCAGGATGTTGAGGG - Intronic
1094463582 12:30725928-30725950 AAAATCTTAAATGATATTCATGG - Intronic
1097460523 12:59856619-59856641 AAAATTGACAAGGATATTCAGGG - Intergenic
1098996353 12:77125334-77125356 AAAATCTGCAAGCTTATTGTAGG + Intergenic
1099679991 12:85814798-85814820 AAAATTTACAAGGCTATGAATGG - Intronic
1099697162 12:86037832-86037854 AAAATTCACAAGGATATCCAGGG - Intronic
1099892486 12:88606940-88606962 AAAATTAACAAGGACATTCAAGG + Intergenic
1100043192 12:90345291-90345313 AAAATCTGCATGGATACTGAAGG - Intergenic
1100136538 12:91559381-91559403 AAAATTAACAAGGATATCCAGGG + Intergenic
1100263905 12:92957893-92957915 GTAATCTACAAGGACATGGAAGG + Intergenic
1100798262 12:98204581-98204603 AAAATTAACAAGGATACTCAGGG + Intergenic
1101116344 12:101535482-101535504 AAAATTTGCAATGATATTCATGG - Intergenic
1101396682 12:104354951-104354973 AGAATCTACAAAGATGATGATGG - Intergenic
1101457320 12:104847945-104847967 AAAATCAACAGTGATATAGAAGG + Intronic
1101600981 12:106210028-106210050 AAAATTAACAAGCATATTCAGGG - Intergenic
1102225696 12:111226879-111226901 AAAATTTACAAGGCTTTTAATGG + Intronic
1103255813 12:119540524-119540546 CAAATCTTCCAGGATCTTGAGGG + Intronic
1104278173 12:127350029-127350051 AAAACCTACAGGGATGTTTATGG + Intergenic
1105385724 13:19927599-19927621 AAAGACTACAAGAATATTCAAGG - Intergenic
1105390643 13:19974461-19974483 AAAAAGTAGAAGGATATTCATGG - Intronic
1105680486 13:22722362-22722384 CAAAACTACAAGGATCTTGGGGG + Intergenic
1105744692 13:23366249-23366271 AATAACTACAAGGAGACTGAGGG + Intronic
1107051732 13:36057935-36057957 AAAATATATAAGCATTTTGAGGG - Intronic
1107617713 13:42188394-42188416 AAAATGCACAAGGATAAGGAGGG - Intronic
1107840189 13:44449728-44449750 AAAATTTACAATGAGAATGAGGG + Intronic
1108151004 13:47534329-47534351 AAAATTAACAAGAATATTCAGGG - Intergenic
1108214513 13:48171188-48171210 AAAATGTACACAGATATGGAAGG - Intergenic
1108541209 13:51448063-51448085 AAAATATACATATATATTGATGG + Intronic
1108600126 13:51985516-51985538 AAAATTAACAACGATATTCAGGG + Intronic
1108918506 13:55647086-55647108 AAAATTTACAAGAAAATTAAAGG + Intergenic
1109146641 13:58788351-58788373 AAAATTAACAAAGATATTTAGGG - Intergenic
1109626237 13:64978689-64978711 AAAACTTACAAGGAATTTGAAGG - Intergenic
1111876777 13:93907098-93907120 AAAATCTACAAGTTTCTTGTGGG + Intronic
1112450442 13:99502992-99503014 AAAATATCTAAGGATATTTAAGG + Intronic
1113076928 13:106476065-106476087 AAAATGTTCAAGGAAATTGCTGG + Intergenic
1114142877 14:19935899-19935921 AAAGTCTACAAGCATCTTGGGGG - Exonic
1114469846 14:22952872-22952894 ATTATATACAAGGATATTAAGGG + Intronic
1114779708 14:25524462-25524484 ATAATCACCAAGGATATGGAAGG - Intergenic
1114812206 14:25913997-25914019 ATGATCTACAAGGATGTTGTAGG + Intergenic
1114884838 14:26835574-26835596 GAAATCTAACAGGATATTGTGGG + Intergenic
1115325081 14:32128740-32128762 AAAATCTAACAGCATATTAAAGG - Intronic
1115357435 14:32463199-32463221 AAAATTAATAAGGATATTCAGGG + Intronic
1115682252 14:35753979-35754001 AAAATCAACAAGTATTTTGTGGG - Intronic
1116572230 14:46532949-46532971 AAAATGAACAAGGATATTCAGGG - Intergenic
1117348594 14:54858787-54858809 AGAAACAACAAGGATATTTAAGG + Intronic
1117947319 14:61041989-61042011 AAAACCTATAAAGATAATGATGG + Intronic
1119404331 14:74387726-74387748 AAAAGCTACTTGGATTTTGATGG - Intergenic
1121508847 14:94497003-94497025 AAAATCCACAGGCAGATTGATGG - Intronic
1121953559 14:98193853-98193875 AAAATCACCAAGGATCCTGATGG + Intergenic
1122273059 14:100577010-100577032 AAAATGTAAAAGGATAATCACGG + Intronic
1123845111 15:24292151-24292173 AAGATTCACAAGGATATTAAGGG - Intergenic
1123860266 15:24458833-24458855 AAGATTCACAAGGATATTAAGGG - Intergenic
1124162899 15:27290144-27290166 AAAATCTTCAAGCTTTTTGAAGG - Intronic
1125091107 15:35793857-35793879 AAACTCAACTAGGATGTTGAGGG - Intergenic
1125266334 15:37885655-37885677 AAAATATACAAGAATGTTTAAGG - Intergenic
1126625758 15:50684733-50684755 AAATTCTACAAGGCAAATGATGG + Intronic
1126750243 15:51869632-51869654 CAGATCTAAAAGTATATTGAAGG + Intronic
1128660017 15:69492881-69492903 AAAATGTAAAACTATATTGAAGG - Intergenic
1129584900 15:76852288-76852310 AAAATTAACAAGGATATTCAGGG + Intronic
1129815094 15:78545194-78545216 AATAGCTAGAAGGATATGGAAGG - Intronic
1130217957 15:81990101-81990123 GACATATACAAGGATATTCATGG - Intergenic
1130775114 15:86971084-86971106 AAATCCTGCAAGGATATTGAGGG + Intronic
1132406937 15:101548319-101548341 AAAATCTCCCAGGATAATGGTGG - Intergenic
1133463706 16:6009515-6009537 AAAATCTACAGGTATTTTGCAGG - Intergenic
1133684588 16:8154249-8154271 AAATTCTACAAAGATAGTGAGGG + Intergenic
1133874423 16:9720383-9720405 AAAATTTACAAGGAGCTTAAAGG + Intergenic
1135338273 16:21623382-21623404 AAATTCTAAAAGTATAATGAGGG - Intronic
1137989518 16:53139501-53139523 AAAAGTCACAAGGGTATTGAAGG + Intronic
1139021154 16:62751539-62751561 AACATCTACATGGATCTAGAGGG + Intergenic
1140084597 16:71783247-71783269 AAAATGTATAAGGATATCAAAGG + Intronic
1141292560 16:82733727-82733749 AAACTCTACCAGGATATAAATGG + Intronic
1141542009 16:84731664-84731686 AAAATCAACAAGGCTATGGAAGG - Intronic
1144491717 17:15718479-15718501 AAAAGCCCCAGGGATATTGAAGG + Exonic
1144908764 17:18660726-18660748 AAAAGCCCCAGGGATATTGAAGG - Exonic
1145881473 17:28355942-28355964 AAAAGCTCCTAGGATACTGAGGG + Intronic
1145925883 17:28646258-28646280 AAAATCTTGAAGGATATATATGG - Intergenic
1146560637 17:33866463-33866485 TAAATGTACAAGGATATTTATGG - Intronic
1149155177 17:53620928-53620950 AAAATATATTAGAATATTGAAGG + Intergenic
1149433286 17:56611865-56611887 AAGATCTAAATTGATATTGAAGG + Intergenic
1150800593 17:68279069-68279091 AATATTTAGAAGCATATTGAAGG + Intronic
1153809146 18:8736619-8736641 AAAAAATACATGGATATAGAAGG - Intronic
1155533054 18:26787097-26787119 GAAATCTACAAGCAAAATGACGG - Intergenic
1155848046 18:30733527-30733549 AAAATTAACAATGATATTCAGGG + Intergenic
1155855546 18:30829993-30830015 AAAATCAACAAACATATTCAGGG + Intergenic
1156520520 18:37718667-37718689 GACACCTACAAGGATATTTATGG - Intergenic
1156799720 18:41095389-41095411 AAAATATAAAAGAATTTTGATGG + Intergenic
1158098272 18:53800120-53800142 AAAAACTGTAAGGATATAGAAGG - Intergenic
1158923437 18:62222673-62222695 AAAATCTTTTAGGATATAGAAGG + Intronic
1159253657 18:65916258-65916280 AAAATCTACATGGTTAATTATGG - Intergenic
1159268694 18:66120109-66120131 ACAATTTTCAAGGAAATTGAAGG + Intergenic
1159738010 18:72127425-72127447 AAAATATAAAAGAATATTCATGG - Intergenic
1164847424 19:31445753-31445775 AACATGTACAAGAATATTCATGG + Intergenic
1165536821 19:36454916-36454938 AAAATCTACAAGAAAATTACAGG + Intronic
1166466466 19:43036111-43036133 AAAATCTGCAAGAATATAGTTGG - Intronic
1166885213 19:45956341-45956363 AAAAACTACAAGGGGATGGAAGG - Intronic
1167829842 19:52010615-52010637 AATATGTGCAAGGATATTTATGG + Intergenic
926381054 2:12289919-12289941 TAAATCTAAACAGATATTGATGG - Intergenic
926430603 2:12781855-12781877 ATAATCAACAGGGATATTCATGG - Intergenic
926471473 2:13264927-13264949 AAAATCTAAAAGAGTTTTGAAGG - Intergenic
926736411 2:16076648-16076670 GAAATCTGCAAAGATGTTGAGGG - Intergenic
926970380 2:18461759-18461781 AAAATTAACAAGGATATTCAGGG - Intergenic
927275290 2:21257263-21257285 AAAAGCTACAACGATGTTCATGG - Intergenic
927601156 2:24442659-24442681 AAAATCTTCCAGGATAATTATGG + Intergenic
928049174 2:27970692-27970714 AAAAGCTAAAAGGATATTAATGG - Intronic
928543336 2:32304744-32304766 AAAAACTTCAAGGAAATTCAGGG - Intronic
929213802 2:39388737-39388759 AAAATTTACACTGATTTTGAGGG + Intronic
929402123 2:41596155-41596177 AAAATTTAAAGGGATATTGATGG + Intergenic
929963761 2:46518093-46518115 ACAATCTACAAGCTTACTGATGG + Intronic
930619491 2:53629185-53629207 AAAAGCTCCAAGCAGATTGAGGG - Intronic
930994825 2:57703823-57703845 AAAATCTACATGGATTGTCAGGG + Intergenic
931505398 2:62921045-62921067 AACAGCTAAAAGGTTATTGATGG + Intronic
931542208 2:63341571-63341593 AAAGTCAATAAGGAAATTGAGGG - Intronic
931676971 2:64706911-64706933 AGAATCTACAAGGAACTTAAGGG + Intronic
932080113 2:68706606-68706628 AAAGTCCACAAGGTCATTGAAGG - Intronic
933356277 2:81212998-81213020 CCAATTTACAAGGATATTAATGG - Intergenic
933488019 2:82948132-82948154 AAAATTAACAGGGATATTCAGGG - Intergenic
934121389 2:88843593-88843615 AAAATCTGGAGGAATATTGAAGG + Intergenic
934151835 2:89154486-89154508 AAAATCAACAGGGATATTTTAGG - Intergenic
934215425 2:90027420-90027442 AAAATCAACAGGGATATTTTAGG + Intergenic
935035495 2:99368366-99368388 AAAATATGAAAGGATATTCATGG - Intronic
936725212 2:115305935-115305957 AAAGAGTACAAGTATATTGAGGG + Intronic
937196003 2:120156889-120156911 AAAATCAACAAAGATATTCAGGG + Intronic
937490476 2:122361973-122361995 AAAATGTAAAAAGAAATTGATGG - Intergenic
937679569 2:124629159-124629181 AAAATTAACAAAGATATTCAAGG + Intronic
937848168 2:126604516-126604538 AAAATTAACAAAGATATTAAGGG + Intergenic
938166469 2:129031901-129031923 AAAATCAGCAAGGATATATATGG + Intergenic
939840141 2:147177388-147177410 AAAATCTGCAAGTATAATGATGG - Intergenic
940457363 2:153917409-153917431 AAAAACCAGAAGGTTATTGATGG - Intronic
940593590 2:155762147-155762169 AAAATAAACAATGATATTTATGG + Intergenic
941027818 2:160477756-160477778 AAAGTCTAAAAGGAAAGTGAGGG - Intronic
941161118 2:162035492-162035514 AAAATCTTCAAGGATATATCTGG + Intronic
941392940 2:164937437-164937459 AGAAAATACAAGGATATTGCCGG + Intronic
942057314 2:172196657-172196679 AACATTTACAAAGATATTGGGGG - Intergenic
942205541 2:173616914-173616936 AAAATCTATAAGGATATTCATGG + Intergenic
943877571 2:193091133-193091155 AAAGGCTATAAGGATGTTGATGG - Intergenic
943973584 2:194442321-194442343 AAAATTAACAAGGATATTCAGGG + Intergenic
943980391 2:194542227-194542249 AAAATTAACAAGGATATTCAGGG - Intergenic
944135109 2:196390648-196390670 AAAAACAACAAGGTTATAGATGG - Intronic
944327319 2:198421652-198421674 AACATTTACAATGATATTGTAGG + Intronic
944716277 2:202377723-202377745 AAAATACACAAGAATATTAAAGG - Intronic
945207498 2:207347044-207347066 AAAATTAACAAGGATATTCAGGG + Intergenic
945353401 2:208809315-208809337 AAAATTTCCAATGATAATGATGG - Intronic
945418100 2:209599878-209599900 AAAACTTATTAGGATATTGAGGG + Intronic
945434317 2:209801095-209801117 AAAATTAACAAGGATATTCAGGG - Intronic
945767027 2:213993598-213993620 AAAAGCTATATGGATATTTATGG - Intronic
945797878 2:214387093-214387115 AAAATATAAAAGGAAGTTGAAGG - Intronic
946698595 2:222386747-222386769 ACAATCTACATGGAGATAGATGG - Intergenic
946913283 2:224487705-224487727 AAAATTAACAAGGATATTCAGGG + Intronic
946928065 2:224645172-224645194 AAAATCAGCAAGGATAATGGAGG - Intergenic
947032220 2:225809639-225809661 AAATTCTGCAAGAATTTTGATGG - Intergenic
947465783 2:230344062-230344084 AAAATAAACAAAGATATTCAGGG - Intronic
948300029 2:236898656-236898678 TAAATATACAAGCATATAGAGGG + Intergenic
1168933245 20:1642134-1642156 AAAATTAATAAGGATATTCAGGG - Intronic
1169759607 20:9076688-9076710 AAAAGCAACAAGGAAAATGAGGG - Intronic
1169885026 20:10389605-10389627 AAAATCTTAAAGGATTTTCATGG + Intergenic
1169980853 20:11382147-11382169 AAAATTAACAAGGATATTCAGGG + Intergenic
1170229108 20:14025886-14025908 AAAATTAACAAGGATATTCAGGG - Intronic
1170355108 20:15483852-15483874 AAAATCTACTAGTTTATTGTTGG + Intronic
1170450369 20:16477170-16477192 AAAACCCACAAGGAAATTGAAGG - Intronic
1170652451 20:18255267-18255289 AAACTCTACAGGGAAATTGTGGG - Intergenic
1170931592 20:20773673-20773695 AAAAACTAAAAGGCTAATGATGG + Intergenic
1174308681 20:49633378-49633400 AAAATCTTCAAGGCTACTGATGG - Exonic
1174631359 20:51960805-51960827 AAAATCTAAAATGTTCTTGAGGG - Intergenic
1174756385 20:53162624-53162646 AACATCTACAAGGACAAGGAAGG - Intronic
1177165096 21:17592235-17592257 AAATCCTCCAAGGATACTGAGGG - Intronic
1177165379 21:17596637-17596659 AAAACATACAAATATATTGATGG - Intronic
1177410416 21:20722665-20722687 AAAGTCTATAAGTATCTTGATGG + Intergenic
1177662295 21:24100927-24100949 AAAATTTACAAAGCTATTCAGGG - Intergenic
1177668656 21:24195676-24195698 AGAATCTAACAAGATATTGAGGG - Intergenic
1177746872 21:25226250-25226272 AAAATCTATATGGAAATTTAAGG - Intergenic
1177755801 21:25346243-25346265 AAAATTAACAAGGATATTCAGGG - Intergenic
1178810879 21:35880102-35880124 AATATCTACAAATATATTGCTGG - Intronic
1179118573 21:38520373-38520395 AAAATCAAAAAGGATATTTGAGG - Intronic
1181316739 22:21975409-21975431 ACAATTTACAATGAAATTGAAGG - Intronic
1183159860 22:36105372-36105394 AAAGTCTTCAAGGTTTTTGAAGG + Intergenic
949195183 3:1296818-1296840 AGAATCTCCAAGTATATTGTTGG - Intronic
949738388 3:7200849-7200871 AAAATCTACTAGGTTACTAAAGG - Intronic
949792163 3:7804691-7804713 AAAATATACAAAGAGATGGAGGG + Intergenic
950465336 3:13149919-13149941 AAAATCATCCAGGCTATTGATGG + Intergenic
950588771 3:13919241-13919263 GATATCAACAAGGATATTTAGGG + Intergenic
950720415 3:14878481-14878503 AAAAACAACAAGGATAATGATGG + Intronic
950753149 3:15146844-15146866 AAATACTACAAGGAGACTGAAGG - Intergenic
951316951 3:21198928-21198950 TAAATCTACAAGGCTTTTGGTGG + Intergenic
951434001 3:22641139-22641161 AAAATTAACAAGGATATCCAGGG - Intergenic
952038393 3:29232322-29232344 AAAACCTACAGAAATATTGATGG + Intergenic
952203608 3:31156658-31156680 AAATTTTACTAGAATATTGAAGG - Intergenic
952462110 3:33538577-33538599 AAAATCTAAAAGGAATTTGAAGG + Intronic
952576857 3:34784801-34784823 AGAATATACAAGAATATTTATGG - Intergenic
954728202 3:52634504-52634526 AAAATGGATAAGGATATTAAAGG - Intronic
955121938 3:56069080-56069102 AAAATTAACAAGGATATGCAGGG - Intronic
955303166 3:57803497-57803519 TACATCTACAAGGATCTAGATGG - Intronic
956063245 3:65369857-65369879 GATATCTACAAGGAGACTGAAGG - Intronic
956365168 3:68493760-68493782 AAAATTTAAAAAGAAATTGAAGG + Intronic
957475089 3:80712025-80712047 AAATTTAACAAGGATATTCAGGG + Intergenic
957960522 3:87244852-87244874 AAAATCTGCAGTGATATAGAAGG - Intronic
959407444 3:105977441-105977463 AAATACTACAAGGATTGTGAAGG - Intergenic
959880956 3:111444642-111444664 AAAATTAACAAGGATATTCAGGG - Intronic
962131034 3:132676737-132676759 AAAACCTCAAAGGATATTGTAGG + Exonic
962667369 3:137668651-137668673 AAAATCTACAGGGATGGGGATGG - Intergenic
963338644 3:144006959-144006981 AAAGACGACAAGAATATTGATGG - Intronic
964642853 3:158928543-158928565 AGAATTTACAGGGATATTCAAGG - Intergenic
966364008 3:179162737-179162759 AAAATCTACTTGGATGTTGGAGG + Intronic
967410456 3:189161817-189161839 AAAAGGTAAAAGGATATGGAGGG + Intronic
969143001 4:5096218-5096240 AAATTCTAAAAGGATATTTTAGG - Intronic
970476612 4:16430236-16430258 AAATTCTACAAGGGTAAAGAGGG + Intergenic
970481081 4:16475852-16475874 AAAATCTTCAACTATATTTATGG - Intergenic
971097125 4:23419875-23419897 AAAATTTACAAGGATTGTAAAGG - Intergenic
972145212 4:36015628-36015650 AAAATCTGCAAGGTAATTCATGG + Intronic
972249304 4:37282747-37282769 AAATTCTCCAAGGATACTCATGG - Intronic
973009860 4:45058972-45058994 AAAATCAGTAAGGATATAGAAGG + Intergenic
973256232 4:48116497-48116519 TAAAACTACAAGGATAGTGCAGG + Intronic
974296899 4:60011921-60011943 AAAATCTATAAAAACATTGAGGG + Intergenic
974329995 4:60465728-60465750 AAAATGAAGAAGGATATTGAAGG + Intergenic
974825570 4:67124982-67125004 AAAATAAACAAAAATATTGATGG + Intergenic
974833205 4:67214485-67214507 AAAATCTAAAGGTATACTGATGG - Intergenic
974962170 4:68716759-68716781 AAAATATAGAAGGAAACTGAAGG - Intergenic
975911498 4:79272592-79272614 AGAAACTACAATGATATTTAGGG + Intronic
976527606 4:86112755-86112777 AAAATTAACAAAGATATTCAGGG - Intronic
976975070 4:91155753-91155775 AAAAGATAACAGGATATTGAAGG + Intronic
977045472 4:92063988-92064010 AAAATCTTGAAGGCGATTGAAGG + Intergenic
977117411 4:93048020-93048042 AAAATCACAAAGTATATTGATGG + Intronic
978103377 4:104871473-104871495 AAAATCTCCACGGATATTCCTGG + Intergenic
978557988 4:110001417-110001439 AAAAATTACAATGTTATTGATGG - Intronic
979135645 4:117109440-117109462 AAAATCTAATGGGATTTTGATGG - Intergenic
979337856 4:119484144-119484166 AAAATTAACAAAGATATTCAGGG + Intergenic
979587985 4:122443864-122443886 AAAATTAACAAGGATATTCAGGG - Intergenic
980477629 4:133338435-133338457 AAAATTAACAAAGATATTCAGGG - Intergenic
980787135 4:137570606-137570628 AAAATTAATAAGGATATTCAGGG - Intergenic
980797375 4:137701745-137701767 AAAGTCTTCAAGAATAATGAAGG + Intergenic
981052688 4:140326346-140326368 AAAATCAACGAGGATGTTTAGGG + Intronic
981180649 4:141739551-141739573 AAACTCTTCAAAAATATTGAAGG + Intergenic
981830955 4:149001220-149001242 AAAATAGACAAGAATAGTGAAGG - Intergenic
982762036 4:159296431-159296453 AAAATTCTCATGGATATTGATGG - Intronic
983122340 4:163902080-163902102 AAAATCTACAGGGATGGGGAGGG + Intronic
983730108 4:170982890-170982912 AAATTCTCTGAGGATATTGAGGG + Intergenic
985214599 4:187637508-187637530 AAAAACTTTAAGTATATTGAAGG + Intergenic
987889465 5:23857452-23857474 AAAATTAACAAGTATATTCAGGG + Intergenic
989607637 5:43260107-43260129 AAAATCTACGAGTCTTTTGAAGG + Intronic
990138423 5:52675479-52675501 AAAATCTACAAAGATTTTAGAGG - Intergenic
990669190 5:58108354-58108376 AAAATTTAGAAGGACATAGAAGG + Intergenic
990711892 5:58591275-58591297 AAAATCGATAAGGATATTAAAGG - Intronic
991140615 5:63237146-63237168 AAAATCAACAAGAATAAAGAAGG - Intergenic
991538500 5:67700235-67700257 AAAATCTTTAATCATATTGATGG + Intergenic
992041951 5:72843623-72843645 AAAAACTACTATGTTATTGAAGG + Intronic
993163234 5:84316709-84316731 AAAATTAACAAGGATATCCAGGG + Intronic
993513157 5:88797167-88797189 AAAATTAACAAGGATATTCAGGG - Intronic
995979607 5:118085711-118085733 AAAAAGTAGAAGGATATTTAGGG - Intergenic
996050874 5:118931691-118931713 AAAATCAGTAAGGATATTGTTGG + Intronic
996337893 5:122404534-122404556 AAAATAAAAAAGGATATTGATGG + Intronic
996426353 5:123317816-123317838 AAAATTAACAAGGATATTCAGGG - Intergenic
996481975 5:123986158-123986180 AAAATTAACAAAGATATTCAGGG - Intergenic
997703822 5:135928773-135928795 AATATCTACAAAAATATTGCTGG - Intronic
998723210 5:144977145-144977167 AAAACCTACAAGGAGATTCAAGG + Intergenic
999420207 5:151434550-151434572 AAAATCTAAAAGAAAAGTGAGGG + Intergenic
999429726 5:151515676-151515698 AGATTCTACAAAGATTTTGAAGG - Intronic
999910214 5:156189294-156189316 AAAATCTAAAGGCAAATTGATGG + Intronic
1000570398 5:162905571-162905593 AATAACTAAAAGGATATAGAAGG + Intergenic
1000823876 5:166019623-166019645 AAGATGTACAGGGATATTTATGG + Intergenic
1000845056 5:166269390-166269412 AAAATCTAAAAAGATATTAATGG - Intergenic
1000975321 5:167758107-167758129 AAAATCTCTTAGGAAATTGATGG + Intronic
1001789959 5:174447660-174447682 AAGGTCTCCAAGGGTATTGATGG + Intergenic
1001977343 5:176010961-176010983 AAAAACTACAAAAATACTGAGGG + Intronic
1002240083 5:177832818-177832840 AAAAACTACAAAAATACTGAGGG - Intergenic
1002354599 5:178615247-178615269 AAATTCTAAAAGGACATTAATGG + Intronic
1002796631 6:476508-476530 AAAATCTACTAGTATGTTTATGG + Intergenic
1003075279 6:2978522-2978544 GAAATTTACAAGGAGAATGATGG - Intergenic
1003609880 6:7602292-7602314 AAATTCTGCATGGATACTGAGGG + Intronic
1003992776 6:11503194-11503216 AAAATCAGTAAGGATATAGAAGG - Intergenic
1004805871 6:19203117-19203139 AAAATTGACAAAGATATTCAGGG - Intergenic
1008375991 6:50792714-50792736 CAACCCTACAAGCATATTGAGGG + Intergenic
1008676822 6:53827867-53827889 AAAACCTACAAAAATGTTGATGG + Intronic
1008759573 6:54837513-54837535 TTAATATACAAGGATGTTGATGG + Intergenic
1009612373 6:65963123-65963145 AAAATAAAGAAGGATTTTGAAGG - Intergenic
1009730710 6:67601669-67601691 GAAATCCACAAGGATGCTGATGG - Intergenic
1010340532 6:74746654-74746676 AAAACCTACAAGCATACTGTGGG + Intergenic
1010867681 6:80999823-80999845 ATTATGTACAAGGATATTAAGGG - Intergenic
1012082811 6:94783006-94783028 AAAATTAACAAGGTTATTTAGGG - Intergenic
1012200228 6:96397197-96397219 AAAATGAACAAATATATTGAAGG + Intergenic
1012439611 6:99251239-99251261 AATATCTACAACCATTTTGATGG + Intergenic
1012856248 6:104505525-104505547 TAAATCTACAAGTTTATTCAGGG - Intergenic
1012899245 6:104988042-104988064 AAAAAATAGAAGAATATTGATGG - Intronic
1013218643 6:108055733-108055755 AAATTCTAAAATGATAATGAAGG + Intronic
1013655086 6:112238168-112238190 AAACTCTTCAAGGATATAGAAGG - Intronic
1013708446 6:112868512-112868534 AAAATCTTCAATGTTATTGCAGG - Intergenic
1014636676 6:123855978-123856000 AAAATCTTAAAAGATATTGTGGG - Intronic
1014967921 6:127779940-127779962 AAAATTAACAAGGATATGCAGGG - Intronic
1014986918 6:128022607-128022629 AAAATCTTCATTGATTTTGAAGG + Intronic
1015221378 6:130807507-130807529 AAAACCTACTGGGATTTTGAGGG - Intergenic
1015648104 6:135418343-135418365 TAAATTTAGAAGGATTTTGATGG - Intronic
1016787600 6:148029379-148029401 AAAATCAGCAAGGTTATAGAAGG + Intergenic
1016973013 6:149782676-149782698 AGAATCAACAAGAATAATGATGG + Intronic
1017561913 6:155637119-155637141 AAAATATAAAATGATACTGAAGG + Intergenic
1018437536 6:163776329-163776351 AAAATGTACAAGGCTAGTGAGGG + Intergenic
1018481407 6:164194768-164194790 AAAAACAAAAAGGATATTGGGGG + Intergenic
1020745620 7:12074889-12074911 AAAATTGAAAGGGATATTGAAGG + Intergenic
1020935205 7:14455086-14455108 AAAATTAAAAAGTATATTGATGG - Intronic
1021440623 7:20670149-20670171 AAAATGTACTGGGATATTCAGGG + Intronic
1021465056 7:20933095-20933117 AAATACCACAAAGATATTGAAGG - Intergenic
1021916740 7:25441628-25441650 AAAATCAACCAAGATATTCAGGG - Intergenic
1022754553 7:33271808-33271830 AAAATTAACAAAGATATTCAAGG + Intronic
1023760418 7:43460665-43460687 AAAATGGAGGAGGATATTGATGG + Intronic
1023783236 7:43678976-43678998 AAAATTTATAAGTATCTTGAGGG + Intronic
1024149940 7:46561047-46561069 AAAATCAACAAGGATATTTCAGG - Intergenic
1025846823 7:65206676-65206698 AAAATAAACAAGGATATACAAGG - Intergenic
1028648513 7:93123938-93123960 AAAATTAACAAGGAAATTCAGGG + Intergenic
1028663067 7:93305740-93305762 TAACTCTACATGTATATTGAGGG + Intronic
1028677871 7:93488863-93488885 AAAATTAGCAAGGATATTCAGGG + Intronic
1030410807 7:109177551-109177573 TATATCAACAAGGATATTAAAGG + Intergenic
1030513828 7:110517659-110517681 AAATTCTTCAAGGATATAAAAGG - Intergenic
1031096899 7:117431097-117431119 AAAATTAACAAAGATATTCAGGG - Intergenic
1031515712 7:122695859-122695881 AAAATGAACAAGGATGTGGAGGG + Intronic
1031902393 7:127425990-127426012 AAAATTAACAAGGATATTCAGGG - Intronic
1032111046 7:129075902-129075924 GAAATCTACAAGGATAGTTTTGG - Intergenic
1032427047 7:131830695-131830717 AAGAGCTACAAGGAGGTTGATGG - Intergenic
1032645310 7:133817437-133817459 GAGATCAACAAGGAGATTGAAGG + Exonic
1032958174 7:136998261-136998283 GAGATGTACCAGGATATTGAAGG + Intronic
1033289256 7:140068684-140068706 AATATCAGCAAGGATATAGAAGG + Intergenic
1033391319 7:140930724-140930746 ATAAACTACAAGGATATTTTTGG + Intergenic
1033636547 7:143217484-143217506 CACTTCTACAAAGATATTGAGGG + Intergenic
1035491944 7:159287161-159287183 AAAATTAACAAGGATATTCAGGG + Intergenic
1036097060 8:5735999-5736021 AAAATGTACTAAGATATTTAAGG - Intergenic
1036216397 8:6883351-6883373 AATATATAAAAGGATATTTAAGG + Intergenic
1038119842 8:24600880-24600902 AAAATCTTCAAAGATTTTTATGG + Intergenic
1038370910 8:26989481-26989503 GAAGTCTACAAGGAAATAGAAGG + Intergenic
1039358497 8:36848164-36848186 AGAATATACAAGGAACTTGATGG - Intronic
1039667561 8:39551550-39551572 AAAATATACACAGATTTTGAAGG - Intergenic
1039736768 8:40340838-40340860 AAAGTCTACAAGAAAATTGTTGG - Intergenic
1040841495 8:51790056-51790078 AAAATCTATGAGGTTATTCAAGG + Intronic
1041130257 8:54691393-54691415 TAAATCTAGAAGGATTTAGAAGG + Intergenic
1041321298 8:56616201-56616223 AAAATCTGCAAGGATGCAGAAGG - Intergenic
1041745962 8:61209804-61209826 AGATTGTACAAGGATATTGGTGG - Intronic
1041907156 8:63046233-63046255 AAAATTAGCAAGGATATTCAGGG - Intergenic
1042599527 8:70484554-70484576 AAAATCTCCAAGTACTTTGAAGG - Intergenic
1045234721 8:100340930-100340952 AGAATCTACAAGGAACTTAAAGG - Intronic
1045354162 8:101370419-101370441 AGACACTAAAAGGATATTGAAGG - Intergenic
1045738288 8:105320484-105320506 AAAAACTACAAGGCAATTGGTGG - Intronic
1045832947 8:106486898-106486920 AAAAACTACATTGATGTTGAAGG - Intronic
1046520050 8:115312719-115312741 AAAATATACAAGGATAGCCATGG - Intergenic
1048109043 8:131446547-131446569 AAAATCTAAAAACATATTCAAGG - Intergenic
1050882613 9:10721753-10721775 AGAAAATACTAGGATATTGAAGG - Intergenic
1051041045 9:12811516-12811538 AAAATGTTCAAGGAAACTGAAGG - Intronic
1051180407 9:14405947-14405969 GAAATCTACTAGGTTTTTGAGGG + Intergenic
1051866063 9:21684328-21684350 AATAGCTACATGGCTATTGACGG - Intergenic
1052226658 9:26097085-26097107 CAAATCTTTAAGGATATTGCAGG - Intergenic
1052427888 9:28328442-28328464 ATATTCTACAAGGATGCTGAAGG - Intronic
1055061694 9:72075115-72075137 AAAATTAACAAGGATATTCAGGG + Intergenic
1055062620 9:72085937-72085959 AAAATCAAGAAAGCTATTGAAGG - Intergenic
1055277045 9:74629709-74629731 AAAATAATAAAGGATATTGATGG - Intronic
1055576480 9:77665039-77665061 AATATTTACAAGAATATTAAGGG + Intergenic
1055984188 9:82039443-82039465 AAAATTTACTTGGTTATTGAGGG + Intergenic
1056408051 9:86295408-86295430 AAAATGTACAAGGAAATATATGG + Intronic
1056429031 9:86508417-86508439 AATATGTACAAGGAAAGTGAAGG - Intergenic
1057070845 9:92098501-92098523 AGAAACTACAAGAAAATTGAAGG - Intronic
1058718922 9:107746113-107746135 AAAAGCTACAAGGAAATTCCCGG + Intergenic
1058779889 9:108322677-108322699 AAAGTCTACAAGGACTTGGAGGG - Intergenic
1059090055 9:111346913-111346935 AAGATCAACAAGGATGTAGAAGG + Intergenic
1059520955 9:114941699-114941721 AACATCTACAGGGAAATTAAAGG - Intergenic
1059886246 9:118747879-118747901 AAAATCTTCAAAAATGTTGAAGG - Intergenic
1060841385 9:126795874-126795896 AAAATCTACAATGTCTTTGAGGG + Intergenic
1203459789 Un_GL000220v1:24100-24122 AAAATTAACAAGGATATTCAGGG - Intergenic
1186061524 X:5713265-5713287 AAAATTAACAAGGATATTCAGGG - Intergenic
1186972032 X:14857293-14857315 AAAATCTGCAAGAATATACAGGG + Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1187498756 X:19820247-19820269 AAAATCAGCAAGGGTATAGAAGG - Intronic
1188543999 X:31282194-31282216 AAAATCTGCAAAAATATAGAAGG - Intronic
1188694067 X:33166888-33166910 TAAATCTAGAAGGCTATTAATGG + Intronic
1188771546 X:34160047-34160069 AAAATTAACAAGGACATTCAGGG - Intergenic
1189091507 X:38088002-38088024 ATATTTTACAAGGATATTGGGGG + Intronic
1189540813 X:41986388-41986410 AAAATGTAGAAAGAAATTGAAGG + Intergenic
1191736009 X:64388454-64388476 AAGATGTACAAGGTCATTGAAGG + Intronic
1191886314 X:65892199-65892221 AAAATTAACAAGGATATCCAGGG - Intergenic
1191966488 X:66764638-66764660 AAAATCAGCAAAGATATTCAGGG - Intergenic
1192020830 X:67388840-67388862 AAAATTAACAAGGATATCCAGGG + Intergenic
1192966282 X:76180828-76180850 AAAATTAACAAGGATATTCACGG - Intergenic
1192977899 X:76305771-76305793 AAAATCTACAAGTATCAAGATGG - Intergenic
1193368580 X:80664814-80664836 AAAATTAACAAGGATATAAAAGG - Intergenic
1193844590 X:86453354-86453376 AAAATTAACAAAGATATTCAGGG - Intronic
1194824827 X:98549055-98549077 ATAATCTAAAATGATCTTGAAGG - Intergenic
1195033625 X:100950486-100950508 AAAATCAAAAAGGATATAGAAGG + Intergenic
1195859457 X:109367349-109367371 AAAATTTACAAGATTCTTGAAGG - Intergenic
1196433016 X:115647555-115647577 AAGATCTTCCAGGACATTGAGGG - Exonic
1197039939 X:121924642-121924664 AAAATTAACAAAGATATTTAGGG + Intergenic
1197316722 X:124975243-124975265 ACAATCTTCAAGGAAACTGAAGG + Intergenic
1197442148 X:126505108-126505130 AAAATCTACTAGGATCTGGTAGG + Intergenic
1197506263 X:127308399-127308421 AAAATTAACAAGGATATTCAGGG + Intergenic
1198115809 X:133543773-133543795 AAAATATGCAAGGCTAATGATGG + Intronic
1198195402 X:134355695-134355717 AAAATCTAATAGGATATCCAAGG + Intergenic
1198697920 X:139363541-139363563 AGAAACTAGAAGGACATTGATGG - Intergenic
1199589120 X:149450010-149450032 AAAATTAACAAAGATATTTAAGG - Intergenic
1199748991 X:150796602-150796624 AAAATCTACAAGGATATTGAAGG + Intronic
1201422038 Y:13810255-13810277 AAAATGAACAAGGATTTTCAAGG - Intergenic
1201933788 Y:19384313-19384335 AAAATTAACAAGGATATTCAGGG - Intergenic