ID: 1199750890

View in Genome Browser
Species Human (GRCh38)
Location X:150816412-150816434
Sequence ACCAAGGCTTGGAGCCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199750890_1199750897 26 Left 1199750890 X:150816412-150816434 CCTTGAGGGCTCCAAGCCTTGGT 0: 1
1: 0
2: 0
3: 14
4: 222
Right 1199750897 X:150816461-150816483 AACATAGATAATCCTGCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 119
1199750890_1199750893 -4 Left 1199750890 X:150816412-150816434 CCTTGAGGGCTCCAAGCCTTGGT 0: 1
1: 0
2: 0
3: 14
4: 222
Right 1199750893 X:150816431-150816453 TGGTTCCACAACTATCAACCTGG 0: 1
1: 0
2: 1
3: 7
4: 87
1199750890_1199750896 25 Left 1199750890 X:150816412-150816434 CCTTGAGGGCTCCAAGCCTTGGT 0: 1
1: 0
2: 0
3: 14
4: 222
Right 1199750896 X:150816460-150816482 AAACATAGATAATCCTGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199750890 Original CRISPR ACCAAGGCTTGGAGCCCTCA AGG (reversed) Intronic
900204581 1:1426597-1426619 TACAAGGCTGGGAGGCCTCAGGG - Intronic
903995131 1:27300793-27300815 TCCAAGGCAGGGGGCCCTCAAGG - Intronic
906214078 1:44029215-44029237 GCCAAGCCCTGGAGTCCTCACGG + Intronic
907192576 1:52661534-52661556 AGCAAGGCATGGAGCTCTCCTGG - Intronic
907349190 1:53811824-53811846 ACCAAAGCTAAGAACCCTCATGG + Intronic
908175069 1:61547424-61547446 ACCAAAGCTAGGGACCCTCATGG - Intergenic
910473771 1:87584073-87584095 ACCAAAGTTAGGAGCCATCAGGG + Intergenic
910968528 1:92831587-92831609 TCCCAGGCTTGGGGCTCTCAGGG + Intergenic
912353683 1:109038245-109038267 ACCAAGGCTAGGAGCTCTGAAGG - Intronic
914407365 1:147389532-147389554 TCCAAGCCTTGGGGCCCTCTTGG - Intergenic
915597520 1:156904048-156904070 GCTAGGGCTTGGTGCCCTCAAGG - Intronic
917916634 1:179708798-179708820 AGTAAGACTGGGAGCCCTCAGGG - Intergenic
920696968 1:208188302-208188324 ACAAAGGTATGGAGCCCTCATGG + Intronic
921478055 1:215633684-215633706 ACCAAAGCTGGGCGCCCACAGGG - Intronic
922697724 1:227739917-227739939 TCCAGGTCCTGGAGCCCTCACGG - Intronic
922739874 1:228008835-228008857 ACCGAGGCTAGGAACCCTCAGGG - Intronic
924386884 1:243507385-243507407 ATCAAGGATTGGGGCCCTCAGGG - Intronic
1064807791 10:19156934-19156956 ACCAAGGCTTCGATCTCTAAAGG + Intronic
1064900195 10:20287707-20287729 ACCCAGTCTTGGGGCCCTCACGG + Exonic
1065489233 10:26265947-26265969 GCCATGGTTTGGAGCCTTCAGGG - Intronic
1067221622 10:44348106-44348128 TCCAGGGCATGGAGCTCTCAGGG - Intergenic
1068096575 10:52499207-52499229 ACCAAAGCTAAGAACCCTCATGG - Intergenic
1069242671 10:66162634-66162656 ACCAAAGCTAAGAACCCTCATGG - Intronic
1069325325 10:67225440-67225462 ACCAAAGCTAAGAACCCTCACGG + Intronic
1069611514 10:69775700-69775722 ACCAAGGCTTACAGGCCTCCAGG - Intergenic
1069706654 10:70462891-70462913 CCCAGGGCTGGGAGCCCACAGGG - Intergenic
1069911999 10:71765522-71765544 CACCAGGCTGGGAGCCCTCAGGG + Intronic
1070692690 10:78539325-78539347 GGCAAGGCTGGGAGCACTCAGGG - Intergenic
1070750323 10:78960256-78960278 TCCAAGCCTTGGAGCTGTCATGG + Intergenic
1070819161 10:79344934-79344956 ACCTGGGCCCGGAGCCCTCAAGG + Intergenic
1073527955 10:104203418-104203440 AACAAGGCTTGGTGGCATCATGG + Intronic
1074387567 10:113028763-113028785 TCCATGGCTGGGAGCTCTCAAGG - Intronic
1075827112 10:125368016-125368038 ACTAAGGCTCAGAGACCTCAAGG - Intergenic
1075982716 10:126755325-126755347 ACCAAAGCTAAGAACCCTCACGG - Intergenic
1076586523 10:131552203-131552225 ACCCAGGCATGGAGACCTGAGGG + Intergenic
1077179673 11:1206753-1206775 ACCAAGGCTGGGGGACCCCAGGG - Intergenic
1077326838 11:1967648-1967670 ACCCAGGCTCGGGGCCCTGAGGG + Intronic
1078288642 11:9983647-9983669 ACCAAAGCTAAGGGCCCTCATGG + Intronic
1080324171 11:31050571-31050593 ACCAAAGCTAAGAACCCTCATGG + Intronic
1080334053 11:31175326-31175348 GCCTAGGCTTTGAGCCATCAGGG - Intronic
1080402337 11:31947609-31947631 ACCAAAGCTAAGAACCCTCAAGG + Intronic
1080606952 11:33871165-33871187 CCCAAGGCTTGGGTCCCTAATGG + Intronic
1081639609 11:44743697-44743719 CCCAAGGCTTGCAGCCCTTTCGG + Intronic
1081685089 11:45036802-45036824 ACCAAGGTAAGGGGCCCTCAAGG - Intergenic
1081812047 11:45919601-45919623 ACCTAGGCTCAGGGCCCTCAAGG + Intergenic
1085200088 11:74696693-74696715 GCCAGGGTTTGGAGCCCACAGGG + Intronic
1085385823 11:76157561-76157583 AGCAAGGCTGGGAGGCCTCTTGG + Intergenic
1088206462 11:107397736-107397758 ACCAAAGCTAAGAACCCTCACGG + Intronic
1088388003 11:109281350-109281372 ACCAAGGCTAAGAAGCCTCATGG - Intergenic
1089820171 11:121218581-121218603 TCAAAGGCTTGAAGCCATCAGGG + Intergenic
1090979387 11:131704110-131704132 TCCTAGGCTTTGAGTCCTCAGGG - Intronic
1202809819 11_KI270721v1_random:22828-22850 ACCCAGGCTCGGGGCCCTGAGGG + Intergenic
1093994997 12:25631362-25631384 ACCAAAGCTAAGAACCCTCACGG + Intronic
1094362158 12:29641309-29641331 ACCAAAGCTAAGAACCCTCATGG + Intronic
1096490360 12:52009579-52009601 GCCAAGGCTAGGAGGGCTCAGGG - Intronic
1097152322 12:56987960-56987982 ACTCAGTCTCGGAGCCCTCAAGG - Intergenic
1097295531 12:57958451-57958473 ACCAAAGCTAAGAACCCTCATGG + Intergenic
1099921819 12:88967620-88967642 AGCATGGCTGGGAGGCCTCATGG + Intergenic
1101421294 12:104553487-104553509 AGCATGGCTGGGAGGCCTCAGGG + Intronic
1102916702 12:116759784-116759806 ACCAAAGCTAAGAACCCTCACGG - Intronic
1103237579 12:119386106-119386128 ACCAAGGCTTGCCGCCTTCAGGG - Intronic
1103272152 12:119682207-119682229 CCCAGGGCTTGGAGAACTCATGG - Intergenic
1106033211 13:26020926-26020948 ACCACGGCTGGGAGTCCTGAAGG - Exonic
1106811385 13:33361622-33361644 AGCATGGCTGGGAGGCCTCAGGG + Intergenic
1108716670 13:53086070-53086092 CCCAAGGCTAGGTACCCTCATGG - Intergenic
1111635811 13:90902503-90902525 ACCCAGTCCTGGAGCCCTAAAGG + Intergenic
1111799243 13:92961466-92961488 GCTAAGCCCTGGAGCCCTCAGGG + Intergenic
1114686370 14:24535424-24535446 TCCAAAGCATGGAACCCTCAGGG - Intergenic
1117161709 14:52996070-52996092 TCCAGGACTTGGAGCCATCAAGG + Intergenic
1117639879 14:57786485-57786507 ACCAAAGCTAAGAACCCTCACGG + Intronic
1121016154 14:90550564-90550586 ACAAAGGATTGCAGCCTTCAGGG - Intronic
1122399570 14:101458776-101458798 GCCAAGACTCGGAGCCCTCCCGG - Intergenic
1122557804 14:102591160-102591182 AACAGGGCTGGGAGCCCTCCTGG - Intergenic
1125452862 15:39827025-39827047 ACAAAGGGTTGAAGCCTTCAGGG + Intronic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1127008170 15:54594248-54594270 ACCAAAGCTAAGAGCCCCCATGG - Intronic
1132645335 16:996928-996950 ACAAAGGCATGGAGGGCTCATGG + Intergenic
1133837481 16:9379699-9379721 ACCCAGGCTTGTAGCCACCAGGG + Intergenic
1135810258 16:25580323-25580345 ACCAAGGCTTGGTGAGCTCTGGG - Intergenic
1138119508 16:54387907-54387929 ACTAACGCTTGGAGAGCTCAGGG + Intergenic
1138708026 16:58937793-58937815 AGCATGGCTAGGAGGCCTCAGGG + Intergenic
1140451499 16:75074642-75074664 ACCAAGACATGGACACCTCAGGG + Intronic
1140916001 16:79493922-79493944 ACCTGGGATTGTAGCCCTCAAGG - Intergenic
1143141135 17:4742424-4742446 CCCAAGGCTTGCAGCCTTCATGG + Exonic
1143870946 17:9956972-9956994 ACCAAGGCCTGGAGACCTGTGGG + Intronic
1144216401 17:13059172-13059194 AACTAGGCTTGGAGCCATAATGG + Intergenic
1145974384 17:28975938-28975960 GGAAAGGCCTGGAGCCCTCAGGG + Intronic
1146265972 17:31452977-31452999 ACCAAAGCTTGGAAACCTCTCGG - Intronic
1146303373 17:31709517-31709539 ATCCCGGCTTGGAGTCCTCAAGG - Intergenic
1146934567 17:36804749-36804771 ACCAAGGTCTGGTGCCCTCTGGG - Intergenic
1147448347 17:40488675-40488697 AGCAAGGCCTCGAGCCCCCATGG - Exonic
1147463148 17:40588860-40588882 ACCAAAGCTAAGAACCCTCATGG - Intergenic
1148673632 17:49432055-49432077 ACCCAGGCTTGGACTTCTCATGG + Intronic
1149453684 17:56770229-56770251 ACAAAGGCTTGGAGGCCAGAAGG - Intergenic
1152331061 17:79673274-79673296 TCCACACCTTGGAGCCCTCATGG + Intergenic
1152923168 17:83075995-83076017 ATCAGGCCTTGGGGCCCTCATGG - Intergenic
1160221952 18:76984441-76984463 CCCAGGGGTTGGGGCCCTCAGGG - Intronic
1162158682 19:8696658-8696680 CCCAGGGGTTGGAGCACTCACGG + Intergenic
1163616656 19:18333102-18333124 AGAGAGGCTTGGAGCCCCCAGGG + Intergenic
1163761579 19:19139883-19139905 TCTAAGGCTGGGAGCCCCCAGGG - Intergenic
925453335 2:3990605-3990627 CCACAGGGTTGGAGCCCTCATGG - Intergenic
927328302 2:21832267-21832289 ACCAAAGCTAAGAACCCTCATGG - Intergenic
929658117 2:43754705-43754727 ACCAAGGCTTAGATTCCCCAGGG + Intronic
929722869 2:44388930-44388952 ACCAAAGCTAAGAACCCTCACGG - Intronic
931993066 2:67810038-67810060 ACCAAAGCTAAGAACCCTCATGG + Intergenic
933512411 2:83257784-83257806 AACATGACTTGGGGCCCTCATGG + Intergenic
937855969 2:126672187-126672209 TCTAAGTCTTGGAGCCTTCAAGG + Intronic
938278598 2:130049574-130049596 ACCAGGGCTTGGAGCCCAGCAGG + Intergenic
938329575 2:130440433-130440455 ACCAGGGCTTGGAGCCCAGCAGG + Intergenic
938360373 2:130681070-130681092 ACCAGGGCTTGGAGCCCAGCAGG - Intergenic
938436776 2:131287778-131287800 ACCAGGGCTTGGAGCCCAGCAGG - Intronic
940753386 2:157653904-157653926 CCCATGGGGTGGAGCCCTCATGG + Intergenic
941782767 2:169462532-169462554 GTCAAGGGATGGAGCCCTCATGG - Intergenic
941915053 2:170806370-170806392 AAGAAGGAATGGAGCCCTCATGG + Intergenic
942226903 2:173824270-173824292 AGTAATGCATGGAGCCCTCATGG + Intergenic
942994161 2:182240953-182240975 ACCACGGGGTGGAGCTCTCATGG + Intronic
944715764 2:202375465-202375487 ACCAAGGCTGGGGGCCTTGAGGG - Intergenic
945825686 2:214717394-214717416 ACCAATGCTAAGAACCCTCAAGG + Intergenic
945929575 2:215841620-215841642 AACAAGGCTTGGATTCCACAGGG + Intergenic
947632933 2:231665505-231665527 GCCAAGGCCTGGAGCCCGCAGGG + Intergenic
947638653 2:231693802-231693824 ACCAAGGCTGTAAGCCCCCAGGG + Intergenic
947941015 2:234054901-234054923 AAAAAGGCATGGAGACCTCAAGG - Intronic
948757773 2:240169210-240169232 ACCACGGCCAGGAGCCCTCTGGG - Intergenic
948796777 2:240407402-240407424 AGCATGGCTGGGAGGCCTCAGGG - Intergenic
1169928736 20:10809533-10809555 ACCTAGGCATGGAGCCCTCGAGG - Intergenic
1171313648 20:24166950-24166972 CCCAAGGCCTGGGGTCCTCAAGG + Intergenic
1172656283 20:36540829-36540851 CCCAAGCCCGGGAGCCCTCACGG + Intergenic
1173203132 20:40968853-40968875 ATGAAGGCATGGAGCCCCCACGG + Intergenic
1174276598 20:49408836-49408858 AGCAAGGCTTGGAGCGGTGAAGG - Intronic
1175069110 20:56316765-56316787 ACCAAAGCTAAGAACCCTCATGG + Intergenic
1178482403 21:32990888-32990910 TCCAGGGCTTGGAGCCTGCAGGG + Intergenic
1178959082 21:37047579-37047601 ACCAAAGCTAAGAACCCTCACGG + Intergenic
1183295261 22:37025435-37025457 ACCAAAGCTTGGAGAACTGAGGG + Intronic
1184108539 22:42382455-42382477 ACCCAGGCTGGGTGGCCTCAGGG - Exonic
1184688313 22:46106280-46106302 ACCAAGCCTGGCAGCCCCCAGGG + Intronic
950049812 3:9979061-9979083 CCCAATGCCTGGAGCCCTCGTGG + Intronic
953463407 3:43099490-43099512 CCCATGGCTTGGAGGCCTCATGG - Intronic
954213062 3:49109094-49109116 ACCCAGTCTTGGGGCCCCCAGGG + Exonic
955461574 3:59189429-59189451 ACCAAAGCTAAGAACCCTCAGGG - Intergenic
955765430 3:62339550-62339572 ACCATGGCTGAGAGGCCTCAGGG - Intergenic
957016354 3:75069226-75069248 ACCAAAGTTAAGAGCCCTCATGG - Intergenic
958647052 3:96887516-96887538 ACCAAAGCTAGGAACCTTCAAGG - Intronic
959373494 3:105558956-105558978 ACCCAGGCTTGCAGACCCCAAGG + Intronic
964601207 3:158503310-158503332 ACCAAAGCTAAGAACCCTCACGG - Intronic
965216841 3:165874644-165874666 ACCAAAGCTAAGAACCCTCACGG - Intergenic
965370507 3:167856128-167856150 ACCAAGTCCTGTGGCCCTCAGGG - Intergenic
966117652 3:176484940-176484962 ACCAAAGCTAAGAGCCCTCCTGG - Intergenic
968628641 4:1638986-1639008 ACCAAGGCCTGGATGCCCCAGGG - Intronic
969188439 4:5497517-5497539 CCCAAGGCTTGCAGCTCTCCAGG - Intronic
969283646 4:6188978-6189000 AGCAAGTCTTGGAGCCTTCCAGG - Intronic
979794838 4:124834085-124834107 ACCAAAGCTAAGAACCCTCATGG - Intergenic
979852542 4:125591622-125591644 AGTAAGGCTGGGAGGCCTCAGGG + Intergenic
981312507 4:143310991-143311013 GCAAAGGCTTGGAGCTCTAAAGG + Intergenic
983593140 4:169437045-169437067 ACCAAAGCTTGGTGTGCTCAAGG - Intronic
984266662 4:177505190-177505212 ACCAAAGCTAAGACCCCTCACGG - Intergenic
984280462 4:177664173-177664195 AACAAGGCATGGAGCCCTAATGG - Intergenic
984527507 4:180875205-180875227 ACCAAAGCTAAGAACCCTCACGG - Intergenic
985008581 4:185559683-185559705 ACCAAAGCTAAGAACCCTCACGG - Intergenic
985217703 4:187671661-187671683 ACCAAAGCTAAGAACCCTCACGG - Intergenic
987006017 5:13710030-13710052 ACCAAAGCTAAGAACCCTCACGG + Intronic
987258518 5:16180305-16180327 CCCCGCGCTTGGAGCCCTCAAGG + Intronic
993050145 5:82917069-82917091 TCCAAGGCTTGTAGACCACAGGG - Intergenic
993190137 5:84670595-84670617 CTGCAGGCTTGGAGCCCTCATGG + Intergenic
995817852 5:116191859-116191881 ACCAAAGCTAAGAACCCTCATGG + Intronic
996325451 5:122267749-122267771 ACCAAAGCTAAGAACCCTCATGG + Intergenic
996504741 5:124256941-124256963 ACCAAAGCTAAGAACCCTCACGG - Intergenic
997977682 5:138449828-138449850 ACCATGGCTCAGAGCCCCCAAGG - Intergenic
998138806 5:139688546-139688568 ACCCAGGCCTGGAGCCCTGGAGG - Intergenic
998515478 5:142749940-142749962 AGCAAGGCTGGGACCCCTCTTGG + Intergenic
999936098 5:156486893-156486915 ACCAATTCTTGGAACCCTGAGGG - Intronic
1000714421 5:164623042-164623064 AACAAGCCTTGCTGCCCTCATGG + Intergenic
1001247684 5:170117393-170117415 ACCAAATCATGGAGCTCTCAGGG - Intergenic
1003396568 6:5758489-5758511 ACCTAGGCTTAGAGCCGTGAAGG + Intronic
1004182114 6:13390083-13390105 CACAAGGCTTGGGGTCCTCAGGG - Intronic
1006982078 6:38154927-38154949 ACCCACGCCTGGGGCCCTCAGGG - Intergenic
1007945101 6:45819271-45819293 GCCAAGTCTTGCAGGCCTCATGG - Intergenic
1013852591 6:114534365-114534387 ACCAAAGCTAAGAACCCTCATGG - Intergenic
1014738814 6:125124674-125124696 ACCAAAGCTAAGAACCCTCACGG + Intronic
1015044279 6:128760049-128760071 GCCATGGGATGGAGCCCTCAGGG - Intergenic
1015127408 6:129770159-129770181 ACCAAGGCTTTGAGAGCCCAAGG + Intergenic
1015173109 6:130276787-130276809 ACCTAGCCTTGGAGTTCTCAGGG - Intronic
1016136934 6:140555358-140555380 GCCAAGGCTGGGATCCCTCGTGG - Intergenic
1016987416 6:149905624-149905646 GCCGTGGCTTGGAGCCCCCATGG + Intergenic
1019366398 7:635573-635595 ACCCAGGCCTGGAGCCCGGAAGG + Intronic
1022100536 7:27166589-27166611 AACCAGGCTTGCAGCGCTCATGG - Intronic
1022130866 7:27403212-27403234 AGCAAGGCAAGGAGCCATCATGG - Intergenic
1022443721 7:30453226-30453248 ATCAAAGCCTGGGGCCCTCAGGG - Intronic
1023737943 7:43251137-43251159 ACCACCCCTTGCAGCCCTCAAGG - Intronic
1024038857 7:45533661-45533683 ACCAAGGCCTGGTGGCTTCAGGG + Intergenic
1024545530 7:50514040-50514062 ACCAACGCTAAGAACCCTCACGG + Intronic
1027435562 7:78160432-78160454 ACCTAGGCGTGGAGCTCCCAAGG + Intronic
1027641067 7:80734497-80734519 ACCAAGGGTTGCAGCCTGCAGGG + Intergenic
1027699265 7:81449608-81449630 ACCAAAGCTAAGAACCCTCATGG + Intergenic
1028993527 7:97075716-97075738 ACCAAAGCTAAGAACCCTCATGG - Intergenic
1031761205 7:125715735-125715757 ACCAAAGCTAAGAACCCTCATGG - Intergenic
1032196962 7:129795042-129795064 CCCAAGCCCTGGGGCCCTCAGGG - Intergenic
1034273903 7:149815823-149815845 ACCCAGGAGGGGAGCCCTCAGGG + Intergenic
1035085620 7:156255033-156255055 ACCCAGTCTTGGAGCTCCCATGG + Intergenic
1035601876 8:902020-902042 ACCATGGCTTGGAACCCCCCTGG - Intergenic
1036511233 8:9402318-9402340 ACGGAGGCTTGAATCCCTCAAGG + Intergenic
1038237130 8:25769768-25769790 ACCAAAGCTAAGAACCCTCATGG + Intergenic
1039641514 8:39227897-39227919 ACCAAAGCTAAGAACCCTCATGG + Intronic
1041227814 8:55717411-55717433 ACCAAAGCTAAGAACCCTCAGGG + Intronic
1041333759 8:56756951-56756973 TCTAAGACTAGGAGCCCTCAGGG - Intergenic
1041364220 8:57083844-57083866 ACCAAAGCTAAGAACCCTCATGG + Intergenic
1042088648 8:65134175-65134197 ACCAAAGCTGAGAACCCTCATGG + Intergenic
1042448423 8:68916762-68916784 ATCAAGGTTTGGACTCCTCAAGG - Intergenic
1043459031 8:80441014-80441036 ACCAAGGCTTCGAGACCCCAGGG - Intergenic
1044066556 8:87706208-87706230 ACGCAGGGGTGGAGCCCTCATGG - Intergenic
1047387990 8:124427123-124427145 ACCAAGGCCTGGAGAACGCATGG - Intergenic
1049329233 8:142041232-142041254 ACCATGGCTTTGTGCCTTCAAGG - Intergenic
1049411799 8:142476923-142476945 TACAAGGCTGGGAGCCCTGAGGG - Intronic
1049435621 8:142584913-142584935 TCCTGGGCTTCGAGCCCTCAGGG - Intergenic
1049496135 8:142934503-142934525 ACCAGGGCCTGTGGCCCTCAAGG - Intergenic
1049780433 8:144426294-144426316 ACCCAGCCTGGGAGGCCTCAGGG - Intronic
1050702373 9:8355108-8355130 ATGAAGGCTTGGTGCCCTCACGG + Intronic
1052537183 9:29761852-29761874 ACCAAAGCTAAGAACCCTCATGG + Intergenic
1053023902 9:34715090-34715112 ATCAAGGTTAGGAGCCCTAAGGG + Intergenic
1057288065 9:93776944-93776966 ACCTAGCCTTGGTGCCCTGAGGG + Intergenic
1057389800 9:94633506-94633528 ACCAAAGCATGGAGTACTCATGG - Intronic
1059641378 9:116220006-116220028 ACCAGGGCTGGCAGCCCTCCAGG + Exonic
1061102164 9:128500264-128500286 ATCAGGGCCTGGAGCCCTGATGG + Exonic
1062284047 9:135765280-135765302 ACCAAGGCTGAGAGGACTCAGGG - Intronic
1062372730 9:136248472-136248494 ATCAAGGCTTTGTGCCCTAAGGG - Intergenic
1062482400 9:136758587-136758609 ACCCAGGCTTGCAGCCCGCCTGG + Intergenic
1062712884 9:137986293-137986315 ACCTAGGTGTGCAGCCCTCAGGG + Intronic
1187554451 X:20338691-20338713 ACCCAGGCTGGGACCCCTGATGG - Intergenic
1187681465 X:21771277-21771299 ACCAAAGCTAAGAGCCCTCAGGG + Intergenic
1189953034 X:46251868-46251890 ACCAAGGATTGCATCCCTGATGG + Intergenic
1193420855 X:81280388-81280410 ACCAAAGCTTAGGACCCTCACGG + Intronic
1196819947 X:119693885-119693907 CCCAAGGCTTGGAAACCCCAGGG - Intergenic
1197671611 X:129284150-129284172 GCCAAAGCTAAGAGCCCTCAGGG - Intergenic
1198566079 X:137906834-137906856 GCTATGGGTTGGAGCCCTCATGG + Intergenic
1198989052 X:142490000-142490022 ATGAAGGCCTGGAGCACTCAAGG + Intergenic
1199057812 X:143318831-143318853 ACCAAAGCTAAGAACCCTCACGG - Intergenic
1199750890 X:150816412-150816434 ACCAAGGCTTGGAGCCCTCAAGG - Intronic
1201338059 Y:12902068-12902090 AACTAGGCTTGAAGACCTCAGGG - Intergenic