ID: 1199751144

View in Genome Browser
Species Human (GRCh38)
Location X:150819316-150819338
Sequence TATAGGATATTGAGAGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 1, 2: 10, 3: 60, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199751144_1199751146 6 Left 1199751144 X:150819316-150819338 CCATTTGCTCTCAATATCCTATA 0: 1
1: 1
2: 10
3: 60
4: 232
Right 1199751146 X:150819345-150819367 GTGCACTCACTGAAGCTCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 122
1199751144_1199751147 7 Left 1199751144 X:150819316-150819338 CCATTTGCTCTCAATATCCTATA 0: 1
1: 1
2: 10
3: 60
4: 232
Right 1199751147 X:150819346-150819368 TGCACTCACTGAAGCTCTTTGGG 0: 1
1: 0
2: 2
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199751144 Original CRISPR TATAGGATATTGAGAGCAAA TGG (reversed) Intronic
903086892 1:20869230-20869252 AATAGGATAATGTAAGCAAATGG + Intronic
903292390 1:22322755-22322777 TCTAGAATATGGAGAGCAAAAGG + Intergenic
903539124 1:24086914-24086936 TAGAGGATCATGAGAGCACACGG - Intronic
903875237 1:26469373-26469395 AATAGGGTTTGGAGAGCAAAGGG + Exonic
906349686 1:45047644-45047666 AATAGGATCTTGAGAACAACTGG + Intronic
906390930 1:45415416-45415438 TATGGGATATTGCGAGCAAATGG - Intronic
911238888 1:95442968-95442990 TAGAGGGTATTGAGAGGAAATGG + Intergenic
911748236 1:101465258-101465280 TATAGGAAAGTTTGAGCAAAAGG + Intergenic
912303469 1:108540635-108540657 GATAGGGTTTTGAGAGCAACCGG - Intergenic
913609493 1:120496344-120496366 TAGAGGATATTGAGAAGAGAAGG + Intergenic
917212279 1:172643391-172643413 TGTAGGAAATTGAGAAAAAATGG + Intergenic
919572511 1:199266638-199266660 TATAGGATTTTGTGCCCAAAGGG - Intergenic
920855739 1:209659734-209659756 TTTATGATATTTAGATCAAAAGG - Intergenic
921766734 1:218981674-218981696 TATGGAATATAGAGAACAAATGG + Intergenic
923135811 1:231117738-231117760 GATAGAATACTGTGAGCAAATGG + Intergenic
923647266 1:235836561-235836583 TACGGGATATTGAGTGCAAGAGG + Intronic
1063555030 10:7070211-7070233 TATTGGATATGGAGAGAAAGAGG + Intergenic
1064106588 10:12505648-12505670 TACATAATATTGAAAGCAAATGG + Intronic
1064416519 10:15154706-15154728 TCTAGGATACTGCGAGCAAATGG + Intronic
1064857516 10:19786643-19786665 AATAGGAAAATAAGAGCAAAAGG - Intronic
1065430720 10:25652640-25652662 AATAAGATATTAAGAGTAAAGGG + Intergenic
1065480898 10:26192990-26193012 TCTAGGACTTTGAGAGCTAAGGG - Intronic
1065661886 10:28012667-28012689 TAGAGGATATTAAGCACAAATGG + Intergenic
1066035648 10:31480601-31480623 TACAGTATATTTAGTGCAAATGG - Intronic
1066110112 10:32188229-32188251 TCTAGGATACTGCGAGCAAATGG + Intergenic
1066601847 10:37117403-37117425 TATAGGATATTTGCAGCAAATGG - Intergenic
1071925459 10:90403088-90403110 TATAAGATATCTAGAGAAAATGG - Intergenic
1073698731 10:105900666-105900688 AATAGGATTTTGAGATTAAAGGG + Intergenic
1074441725 10:113483182-113483204 TATAGGATGCTGTGAGCAAATGG - Intergenic
1074578114 10:114690053-114690075 TCTAGGATACTGCAAGCAAATGG + Intergenic
1075032287 10:119031590-119031612 TTTATGATATTAAGATCAAAGGG + Exonic
1075290476 10:121225760-121225782 TATATCATATTTAGGGCAAATGG + Intergenic
1075996091 10:126877424-126877446 TAAAGGAATTTGAAAGCAAAAGG + Intergenic
1077642242 11:3892298-3892320 TCAAGGATACTGCGAGCAAATGG + Intronic
1079770878 11:24458040-24458062 TATAGGATTTTGAAAACTAATGG + Intergenic
1079963185 11:26949155-26949177 TAAATGATATTGAGAAGAAAAGG - Intergenic
1080950108 11:37021908-37021930 TAAAGAAGATTCAGAGCAAATGG - Intergenic
1081063542 11:38510063-38510085 TATTGGGTATAAAGAGCAAAGGG + Intergenic
1081479067 11:43466946-43466968 TATAGGATATTGTGAGCGAATGG - Intronic
1081541099 11:44035142-44035164 GGTAGGATATTGAGAGCAAGAGG - Intergenic
1082844999 11:57717942-57717964 TCTAGGATACTGCGAGCAAATGG + Intronic
1083143985 11:60744207-60744229 TAAAAGATACTGAGAGCCAAAGG - Exonic
1083144063 11:60745259-60745281 TAAAAGATACTGAGAGCCAAAGG - Intergenic
1085856928 11:80185828-80185850 TATAGGAGAGAGAGAGCAACAGG - Intergenic
1085982417 11:81740740-81740762 TATAGGATATTTAGATAAAAGGG + Intergenic
1086427535 11:86701128-86701150 GATAGGATATTTATAACAAATGG + Intergenic
1087632505 11:100667034-100667056 GATAGGATACTGTGAGCAAACGG - Intergenic
1088049404 11:105493002-105493024 TATAGTTTACTGAAAGCAAAGGG + Intergenic
1091214491 11:133892376-133892398 TATAGGAGGGTGAGAGCAGAGGG - Intergenic
1092717000 12:11400095-11400117 TATACGATATAGGTAGCAAATGG - Intronic
1094478636 12:30862256-30862278 TATAGGATACTGTGAGCAAATGG - Intergenic
1094777766 12:33751245-33751267 TATAGGATATTGAGTAAATATGG - Intergenic
1095902395 12:47341516-47341538 TATAGGATATTGCAAGTAAATGG + Intergenic
1096294084 12:50368886-50368908 TATAGTATATTCATAGCATAAGG + Intronic
1097355775 12:58599823-58599845 TATAGGATAGAGAGATCCAATGG - Intronic
1098123533 12:67267469-67267491 GAAAGGCTATTCAGAGCAAAAGG + Intergenic
1098267710 12:68739216-68739238 TGTAGGATATGGAGATTAAAAGG - Intronic
1098882774 12:75933452-75933474 TTTAGGATATTCAGAGAAAGAGG - Intergenic
1099059988 12:77895934-77895956 TACTGGAAATTGAGATCAAAAGG - Intronic
1100015593 12:90006898-90006920 GAAAGCATATTAAGAGCAAAGGG + Intergenic
1100838645 12:98590630-98590652 TCTAGGATACTGCGAGCAAATGG + Intergenic
1100885672 12:99067143-99067165 TTTTGGACATTGAGAACAAAAGG + Intronic
1102909328 12:116700450-116700472 TAGAAGATTCTGAGAGCAAAAGG + Intergenic
1104458787 12:128937259-128937281 TTTAGGATAATTCGAGCAAAAGG + Intronic
1104467684 12:129004033-129004055 TATAGGAAAGTGAGAGCAGCTGG + Intergenic
1105412092 13:20178889-20178911 TATAGGATATTATGAACAAATGG + Intergenic
1105941521 13:25152246-25152268 AATAAGATAATGAGTGCAAAAGG - Intergenic
1107947950 13:45436708-45436730 TCTAGGATACTGTGAGCAAATGG - Intergenic
1108507093 13:51122102-51122124 TTTAGTATATTAAGAGAAAAAGG + Intergenic
1109827865 13:67746389-67746411 TAGAGGCTAGTGAAAGCAAAGGG + Intergenic
1109912033 13:68925151-68925173 TCTATGATAATGAGAGTAAAAGG + Intergenic
1110517618 13:76434309-76434331 TAAAGAAAATTGAGAGTAAAAGG + Intergenic
1110884007 13:80609757-80609779 TATAGAGTATTGAGGGCAAAGGG + Intergenic
1111718029 13:91905218-91905240 CTTAGGATATTGGGAGCATAAGG + Intronic
1111893398 13:94111124-94111146 AATAGGATATTTAGAGAACAGGG - Intronic
1112139440 13:96621915-96621937 TATAGGATTTTGAGGGATAATGG + Intronic
1112536054 13:100256653-100256675 TATAGGATCCTTAGAGGAAAAGG - Intronic
1113114772 13:106863723-106863745 TCTAGGATACTGCGAGCAAATGG + Intergenic
1113726247 13:112604810-112604832 GATATGATATTGAGTGAAAAGGG - Intergenic
1115517068 14:34196094-34196116 CATAGGAAACTGGGAGCAAAAGG - Intronic
1115891308 14:38032587-38032609 AATAAGATATTGAGAAAAAATGG - Intronic
1115986599 14:39108791-39108813 TATAGGATACTGCGAAAAAATGG - Intronic
1116354223 14:43907276-43907298 TGTAGGATAATGAAAGGAAAAGG - Intergenic
1117030786 14:51667877-51667899 GAAAGGATGTTGAGAGCTAATGG + Intronic
1118410836 14:65475915-65475937 TATAGGAAGTTGAGAGGGAAAGG + Intronic
1118699740 14:68421607-68421629 TCTAGGATACTGCGAGCAAACGG + Intronic
1120221877 14:81743550-81743572 TATAGGATATTGGAAGATAAAGG + Intergenic
1124681144 15:31732019-31732041 TACAGGATCCTGAGAGCTAAAGG + Intronic
1125304478 15:38294223-38294245 TAAAATATATAGAGAGCAAAGGG + Intronic
1129260205 15:74362115-74362137 TCTAGGATACTGCGAGCAAATGG - Intronic
1131390313 15:92042758-92042780 TATAGGAGAGTGAAAGCACAAGG + Intronic
1135682029 16:24465561-24465583 TCTATAATATTGAGAGTAAAAGG - Intergenic
1136835947 16:33502162-33502184 TATAGGATATTTGCAGCAAACGG - Intergenic
1136854815 16:33646696-33646718 TATAGGGTGTTGAGAATAAACGG + Intergenic
1137480025 16:48844609-48844631 TATATGAGATGGAGAGCAACTGG + Intergenic
1137793918 16:51198810-51198832 GATAAGAATTTGAGAGCAAATGG + Intergenic
1138459909 16:57142020-57142042 TACAGGAAATTGAGAGCAGGTGG + Intronic
1139086750 16:63596594-63596616 TATATAATTTTCAGAGCAAATGG - Intergenic
1139180137 16:64737352-64737374 TATAGGATATTTTGAGCAAATGG - Intergenic
1140735318 16:77892986-77893008 GATAGGATACTGCGAGCAAATGG - Intronic
1141137455 16:81475618-81475640 TCTAGGATACTGTGAGCAAATGG + Intronic
1203008856 16_KI270728v1_random:221875-221897 TATAGGATATTTGCAGCAAACGG + Intergenic
1203146124 16_KI270728v1_random:1802486-1802508 TATAGGATATTTGCAGCAAACGG - Intergenic
1143266239 17:5640099-5640121 TATTGGAACCTGAGAGCAAAGGG - Intergenic
1143690582 17:8561036-8561058 TACAGGATATTGTGAGCAAGTGG - Intronic
1144467394 17:15507423-15507445 GACAGGATAGTGTGAGCAAATGG - Intronic
1146010531 17:29190980-29191002 TGTAGGATCATAAGAGCAAAAGG - Intergenic
1146080408 17:29774934-29774956 TATAGGATACTGCGAGCAAATGG - Intronic
1146109745 17:30077916-30077938 TATTGGATATGGAAGGCAAAAGG + Intronic
1147430644 17:40368512-40368534 TCTAGGATACTGTGAGCAAATGG - Intergenic
1147577954 17:41613338-41613360 TATAGGATTTTTAGAACAGAAGG - Intronic
1149076790 17:52605281-52605303 TATAGGATGTTAAGAGCAGATGG - Intergenic
1149409381 17:56389465-56389487 TAAAGGATTTAGAGAGAAAAGGG + Intronic
1151837785 17:76594989-76595011 TATAGGTTAATGTGAGTAAATGG + Intergenic
1152056510 17:78032170-78032192 ACTAGGAAATTGAGAGAAAAGGG - Intronic
1152482894 17:80567430-80567452 TGTATGACATTGATAGCAAAAGG - Intronic
1153551525 18:6267106-6267128 TATATGTTATTGACAACAAAGGG + Intronic
1154474404 18:14741792-14741814 TATAGGATATTTGCAGCAAATGG - Intronic
1155586559 18:27373003-27373025 TAAAGGCTATTTAGAGCAGATGG + Intergenic
1156712688 18:39965911-39965933 TAGAGGATATTGGGAGAAAGTGG + Intergenic
1157121474 18:44915341-44915363 TAAAGGATCTTGGCAGCAAATGG + Intronic
1157296379 18:46448038-46448060 TATAGGAGGTTGAGAACACAGGG - Intronic
1159106934 18:64013462-64013484 AATAGGATATTTAGAGGTAAAGG + Intergenic
1159147890 18:64478448-64478470 TATAGGATATTGCTAGTAGATGG + Intergenic
1159561768 18:70002504-70002526 TATAAGATATCGGGAGAAAAGGG + Intergenic
1162700127 19:12508339-12508361 TCTAGGATACTGCAAGCAAATGG - Intronic
1164655960 19:29922041-29922063 TATAGGATACTGTGAGCAAATGG - Intergenic
1164855879 19:31520295-31520317 TGTAGGAGATTGAAAGCAAGGGG - Intergenic
1168233545 19:55047914-55047936 TGTAGGACATTGAGAGCATCTGG + Intronic
1168684833 19:58342419-58342441 TATGGGAAGTTGAGGGCAAAGGG + Intergenic
926269223 2:11352556-11352578 TATAGGATACTGTGAGCAAATGG - Intergenic
926530721 2:14041177-14041199 TACAGGATATTGAGAAAGAATGG - Intergenic
927474108 2:23399186-23399208 TCTAGGATACTGTGAGCAAATGG - Intronic
928313359 2:30228645-30228667 CATAGGATATTGGGAAGAAATGG + Intergenic
929067592 2:37994990-37995012 TTAAGGAGATTGACAGCAAAGGG + Intronic
930139768 2:47939640-47939662 TATAGGATTTTACAAGCAAATGG + Intergenic
930520835 2:52465082-52465104 AATAGGAGAGTGAGAGCTAAAGG + Intergenic
932025268 2:68125819-68125841 TCTAGGATACTACGAGCAAATGG - Intronic
932867228 2:75356471-75356493 TATAGGAAATACAGAGGAAAAGG - Intergenic
933377064 2:81493329-81493351 TATAGGAAAATGAAAGCAAAAGG + Intergenic
934073355 2:88406353-88406375 TATAAAATATAGAGAGTAAAGGG - Intergenic
934110157 2:88734732-88734754 CCTAGGATATTGATAGCATATGG + Intronic
936650868 2:114424295-114424317 GATATGATATTCAGAGCAATTGG - Intergenic
936718597 2:115220860-115220882 CATATGAAATAGAGAGCAAAAGG - Intronic
938214338 2:129496860-129496882 TCTGGGATACTGTGAGCAAATGG - Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
944446813 2:199800178-199800200 TCTAGGAACTGGAGAGCAAAGGG + Intronic
945576665 2:211539106-211539128 TATAGGTTATTCAGAACAATTGG - Intronic
946162535 2:217844570-217844592 AATAGGATTTTGAAAGTAAACGG - Intronic
1169928893 20:10810854-10810876 CATAGGCTACTGAGAGCAAAAGG - Intergenic
1170291195 20:14770704-14770726 TATAGGATATTGTGAGAATTAGG - Intronic
1170406790 20:16046483-16046505 TATAGTTTATTGGCAGCAAAAGG - Intronic
1171046369 20:21811872-21811894 TACAGGAAAGTGAGAGCCAAGGG + Intergenic
1171470612 20:25368181-25368203 TCTAGGATACTGAGAGCAAATGG + Intronic
1172794986 20:37530612-37530634 TCTAGGATACTGGGAGCAAATGG - Intergenic
1173171935 20:40733466-40733488 TACAGAATTTTGAGAGGAAAAGG - Intergenic
1173459456 20:43231326-43231348 TCTAGGATACTGCGAGCAAATGG - Intergenic
1177271831 21:18858345-18858367 TCTAGGATACTGCGAGCAAATGG - Intergenic
1177441490 21:21132351-21132373 TACAGGATCTTGAGATGAAATGG - Intronic
1178005556 21:28216159-28216181 TTTTAGATATTGAGAGCAGAAGG + Intergenic
1178871678 21:36382481-36382503 TACAGGAGATTGAGAACAACGGG - Intronic
1179580045 21:42337630-42337652 GAGAGGCTATTGACAGCAAAGGG + Intergenic
1180013409 21:45066346-45066368 TAGAAGATAATGAGAGCAACTGG + Intergenic
1182157645 22:28090560-28090582 TAAAGAATTTTGAGACCAAAGGG + Intronic
1182714445 22:32345674-32345696 TATTGCATAATGAGAGTAAAGGG + Intergenic
949882051 3:8669504-8669526 TATAGGATACTAAGAAGAAAAGG + Intronic
950895963 3:16450980-16451002 TATAGGATCTTCAGCTCAAACGG + Intronic
952163258 3:30717616-30717638 CATAGCATATTGGGAGAAAAGGG - Intergenic
952602382 3:35100848-35100870 TATAAGACATTGTGAGCAATGGG + Intergenic
953065899 3:39470956-39470978 TTCAGTATACTGAGAGCAAAGGG + Intronic
953658634 3:44873926-44873948 TCTAGGATACTGGGAGCAAATGG - Intergenic
954473364 3:50719388-50719410 TATAGGATGCTGCGAGCAAATGG + Intronic
954932536 3:54296572-54296594 TAGAGGATAATGTGAGCAATTGG - Intronic
955316360 3:57942373-57942395 TCTAGGATACTGCGAGCAAATGG - Intergenic
955604810 3:60690131-60690153 TCTAGGATACTGCGAGCAAATGG + Intronic
955608469 3:60732053-60732075 TCTAGGATACTGCGAGCAAATGG + Intronic
956123118 3:65986051-65986073 TATAGGATAGAAGGAGCAAATGG + Intronic
956928410 3:74014858-74014880 AATAATATATAGAGAGCAAATGG + Intergenic
957166938 3:76686593-76686615 AATATGATCTTGAGAACAAATGG - Intronic
957801873 3:85095276-85095298 TCTAGGAGATTGAGAGAAAATGG + Intronic
958103563 3:89045544-89045566 TATGGGATAATGAGAATAAAAGG - Intergenic
958852210 3:99341698-99341720 TATAGGATATTTAGAAAACATGG - Intergenic
959122764 3:102252718-102252740 TTTAGGATCTTGAGTGTAAAAGG + Intronic
959255863 3:104012649-104012671 TCTAGGATATTTAGAAGAAAAGG + Intergenic
959719554 3:109471235-109471257 TCTAGGATACTTTGAGCAAATGG + Intergenic
960294705 3:115928810-115928832 GAAAGGAAATTGAGAGAAAATGG + Intronic
961090991 3:124112641-124112663 TATAGGATATGGAAAACAGAAGG - Intronic
962369646 3:134810769-134810791 GATAAGATGTTGGGAGCAAAGGG + Intronic
962774186 3:138643423-138643445 TATAGGATACTGTGAGCAAATGG + Intergenic
963176566 3:142303995-142304017 GACAGGGTTTTGAGAGCAAACGG + Intergenic
963828797 3:149984869-149984891 TATAGGATACTGTGAGCAAATGG - Intronic
963985859 3:151593858-151593880 TAGGGGATTTTGAGAGAAAAGGG + Intergenic
965306173 3:167066404-167066426 TCCAGGATACTGCGAGCAAATGG - Intergenic
965370177 3:167852438-167852460 TATGAGAAATAGAGAGCAAAGGG - Intergenic
966302285 3:178493227-178493249 TATAGAATACTGCAAGCAAATGG + Intronic
966344886 3:178968312-178968334 TATAGGAAATGAAGAGGAAAGGG + Intergenic
967734512 3:192938064-192938086 TATTGGATTCTGAGAGCAAGGGG - Intergenic
967898805 3:194425635-194425657 AATATGATATTTACAGCAAAAGG + Intronic
970186707 4:13462695-13462717 TATAGAATATTTAAAGCGAAAGG - Intronic
972590958 4:40486667-40486689 TAGAGGATCTTTAGAGGAAATGG + Intronic
973170283 4:47134152-47134174 TTTAGGATATTGCTACCAAAAGG + Intronic
977475478 4:97502030-97502052 TATAGGAAATTCAGAGAAAAGGG + Intronic
977931039 4:102748930-102748952 TAAAGGATATAAATAGCAAATGG - Intronic
978778657 4:112527200-112527222 TATAAGACACTGAGAGCCAAAGG - Intergenic
981039266 4:140207939-140207961 GAAAGGATATGGAGAGAAAAGGG - Intergenic
981638014 4:146902519-146902541 TAAAGCATAATTAGAGCAAATGG - Intronic
981651670 4:147066521-147066543 TTTAAAATATTGAGAGCAGATGG - Intergenic
982323582 4:154106276-154106298 CATAGCATTTTGAGAGAAAATGG - Intergenic
983273068 4:165586161-165586183 TAAAAGATAATGAGAGCACACGG - Intergenic
983413642 4:167427738-167427760 TATAGTACATTGAGAGTAACTGG - Intergenic
983764198 4:171455879-171455901 AATAGAATATTGATAGCAGAAGG - Intergenic
984502911 4:180579066-180579088 TATATGATATTCAGAGCATTAGG + Intergenic
989404173 5:41042063-41042085 AAGAGGAAATTGAGAGCAAGGGG + Intronic
989469374 5:41797221-41797243 TATAGGAAACTGAGATCAATGGG + Intronic
989564873 5:42892222-42892244 TATAGGATACTGCAAGCAAATGG + Intergenic
990050352 5:51492475-51492497 TAAAGGATACTGTGAGCACAAGG + Intergenic
990403843 5:55468092-55468114 TAAAGGAATTTGAGTGCAAAAGG + Exonic
990583469 5:57187154-57187176 TATAGGAAATTTGGAGCAACAGG + Intronic
991410288 5:66338981-66339003 TAGAGGATATGGAGAGGAACTGG + Intergenic
991433520 5:66572624-66572646 TCTAGGATACTGCGAGCAAATGG - Intergenic
992966664 5:82009505-82009527 TCTAGGATACTGCGAGCAAATGG + Intronic
993214291 5:84999721-84999743 TCTAAGATACTGCGAGCAAATGG + Intergenic
993839509 5:92859882-92859904 TATAAAATATTGAGAGTAAGAGG - Intergenic
993930068 5:93926979-93927001 TTTAGGTCATTGAGAGAAAAAGG + Intronic
994074616 5:95636605-95636627 TATAGGTTCTTGAAATCAAAAGG + Intergenic
994669166 5:102746078-102746100 TATAAGGTACTGAGAGCCAAAGG + Intergenic
995509153 5:112890743-112890765 TATAGTATATAGAGAGTAACAGG + Intronic
996225648 5:120992116-120992138 AATAGGATATATACAGCAAAAGG - Intergenic
997039662 5:130236590-130236612 TAAAGGATATTGAGAGGAAGTGG + Intergenic
998515254 5:142747950-142747972 TATAGGCTGATGAGAGAAAAGGG + Intergenic
1002051414 5:176573751-176573773 TATAGGCTGTAGAGAGCACATGG + Intronic
1003848219 6:10196052-10196074 TCTAGGATAGTGAAAGCTAAAGG - Intronic
1003850995 6:10222413-10222435 TATGGGTTTTTGAGAGTAAAGGG - Intergenic
1005287138 6:24339894-24339916 TATAAGATAGAGAGAGCAAAGGG + Intronic
1005407915 6:25511457-25511479 AATAGGACTTTGAGAGGAAACGG - Intronic
1008495487 6:52128994-52129016 TATAGGATTATGTGATCAAATGG + Intergenic
1008725522 6:54413608-54413630 GTGAGGATAGTGAGAGCAAAAGG - Intergenic
1008818309 6:55597336-55597358 TAAAGCATATTGAAAGAAAAAGG + Intergenic
1009346512 6:62618371-62618393 TATAGGATTTTGTGAGCCAAGGG - Intergenic
1010016585 6:71111174-71111196 TATTGGAGATGGAGAGAAAATGG - Intergenic
1010375698 6:75167343-75167365 TCTAGGAAATTTAGAGGAAAAGG - Intronic
1010557666 6:77304422-77304444 AATAAAATATTGAGAGCCAATGG - Intergenic
1011900510 6:92289209-92289231 TAAAGGATGTAGAGAGTAAAAGG + Intergenic
1012086993 6:94840362-94840384 TATAGGTCATTGGGAGCTAATGG + Intergenic
1012642281 6:101634099-101634121 TATGAGATATGGAGAGCAATAGG + Intronic
1014041453 6:116831805-116831827 AATAGAATCTTGAGATCAAAAGG - Intergenic
1015442489 6:133264589-133264611 TATTGAATGTGGAGAGCAAATGG + Intronic
1021205391 7:17773785-17773807 TCTAGGACATTGAGAGCACAAGG - Intergenic
1021263454 7:18488548-18488570 TCTAGAATTTTGAGCGCAAATGG + Intronic
1021593283 7:22288181-22288203 TAGAGGACAGTGAGAGGAAATGG - Intronic
1022077545 7:26987661-26987683 TATAGGAGAATTAGAGCACATGG - Intronic
1022217524 7:28279121-28279143 TCTAGGATACTGCAAGCAAAAGG + Intergenic
1023945727 7:44801491-44801513 TCTAGGATACTGCGAGCAAATGG - Exonic
1026712492 7:72754873-72754895 TATAAGATAATGAGAGAAAAAGG - Intronic
1027245239 7:76362519-76362541 GATAGGATACTGGGAGCAAATGG - Intergenic
1028637990 7:93012273-93012295 TGTAGAATATTGATATCAAAAGG + Intergenic
1028839684 7:95415116-95415138 TAATGGATGTTGAGAGGAAATGG + Intronic
1029147066 7:98454019-98454041 TCTAGGATACTGCGAGCAAATGG + Intergenic
1029986226 7:104925831-104925853 TATAGGCTATTGAGAAGAGAGGG + Intergenic
1031566653 7:123306504-123306526 TATAAAATATTGAGATTAAAGGG + Intergenic
1032526519 7:132581938-132581960 TAGAGGATATTGTGAGGTAAGGG + Intronic
1037629525 8:20641263-20641285 GAAAGGATAGTGAGAGCAAAGGG - Intergenic
1039287704 8:36060861-36060883 TCTATGATATTGAGGGAAAATGG + Intergenic
1040503557 8:48026561-48026583 TATAGAACAGTGAGAGCTAAAGG - Intronic
1040728180 8:50408867-50408889 TATAGGATTTGGATAGCAAAGGG + Intronic
1040889768 8:52305180-52305202 TATATGATATGGATAGAAAATGG + Intronic
1041497631 8:58504124-58504146 TATAGGATAACGTGAGCAAATGG - Intergenic
1041746600 8:61214102-61214124 GATAGGGTTTTGAGAGCAACCGG - Intronic
1042096925 8:65226427-65226449 TATTAGACATAGAGAGCAAAGGG + Intergenic
1042110692 8:65378187-65378209 TATAGGCTACTGCGAGCAAATGG - Intergenic
1043862236 8:85333227-85333249 TGTAGGAAATTTAGAGGAAAGGG + Intronic
1044258150 8:90090357-90090379 TATAGGATTTGGAAAGGAAATGG + Intronic
1045759577 8:105588343-105588365 TATGGGAAATGTAGAGCAAATGG + Intronic
1046347400 8:112949910-112949932 GATAGGATTTTGATAGCTAAAGG - Intronic
1046415926 8:113914000-113914022 TATAGGATTCTGATAGCAAATGG - Intergenic
1050634655 9:7598446-7598468 TCTAGGATATTGAGAGCAAATGG - Intergenic
1051265955 9:15308192-15308214 GGTAGGAAATTGACAGCAAAGGG - Intergenic
1051871761 9:21746108-21746130 GATAGGATGTTGATAGCTAAAGG - Intergenic
1052006314 9:23353719-23353741 TATAGGATAATGAGGCCAAAAGG - Intergenic
1052054179 9:23884670-23884692 TATAGGATATATAGAGAGAAAGG - Intergenic
1052185782 9:25592121-25592143 TATAGAATAATAAAAGCAAAAGG + Intergenic
1052322968 9:27188197-27188219 TAGAGGATATTGACTGGAAAAGG + Intronic
1052398949 9:27976420-27976442 TATAGTTTTTTGAGACCAAATGG + Intronic
1054927147 9:70600822-70600844 TTTAGGAAAGTGTGAGCAAAGGG - Intronic
1055464309 9:76549188-76549210 TATAGGATACTATGAGCAAATGG + Intergenic
1056966796 9:91169487-91169509 GATAGGCTACTGTGAGCAAATGG + Intergenic
1057378977 9:94552254-94552276 CATAAGATATTGGTAGCAAAAGG - Intergenic
1058014957 9:100020692-100020714 CATTGGATATTTTGAGCAAAAGG - Exonic
1060822004 9:126666518-126666540 GAAAGGAAATTGAGGGCAAAAGG + Intronic
1186557867 X:10579644-10579666 TTCAGGGTATTGTGAGCAAAAGG - Intronic
1186955346 X:14675592-14675614 TATTAGATATGGAGAGAAAATGG + Intronic
1187441170 X:19321703-19321725 GATAGGATTCTTAGAGCAAAGGG - Intergenic
1188702886 X:33287176-33287198 TATATAATATTGAGTGAAAAAGG - Intronic
1189076353 X:37919485-37919507 TTTAGGATACTTAGATCAAAGGG - Intronic
1189671722 X:43417708-43417730 TATAGCATATGTAGAGAAAAGGG - Intergenic
1195018338 X:100800205-100800227 TATAGGCTATTGCCAGCAAATGG + Intergenic
1195050087 X:101089010-101089032 TTTAGGTTAATGAGAGGAAAGGG + Intronic
1196890431 X:120285970-120285992 TAGAGAATATTCATAGCAAATGG + Intronic
1197852356 X:130876454-130876476 TATAGGAAATTGGGAGTTAAAGG + Intronic
1199333734 X:146593725-146593747 TACAGGATATTGAAAACAAATGG - Intergenic
1199751144 X:150819316-150819338 TATAGGATATTGAGAGCAAATGG - Intronic
1199784112 X:151089140-151089162 TAGTGGATATTGAGAGAAATTGG - Intergenic
1200975628 Y:9209539-9209561 GACAGGGTTTTGAGAGCAAATGG + Intergenic
1202135531 Y:21656980-21657002 GACAGGGTTTTGAGAGCAAATGG - Intergenic