ID: 1199751996

View in Genome Browser
Species Human (GRCh38)
Location X:150828651-150828673
Sequence GCTCCATTTGACTACAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199751994_1199751996 -7 Left 1199751994 X:150828635-150828657 CCAGTAAATATATGATGCTCCAT 0: 1
1: 0
2: 3
3: 9
4: 126
Right 1199751996 X:150828651-150828673 GCTCCATTTGACTACAATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 75
1199751993_1199751996 15 Left 1199751993 X:150828613-150828635 CCAAAGAGGCAAATGCAAATGGC 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1199751996 X:150828651-150828673 GCTCCATTTGACTACAATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199751996 Original CRISPR GCTCCATTTGACTACAATCA GGG Intronic
902148455 1:14422902-14422924 GCTCTATTTGACTTCTAACAAGG + Intergenic
904773736 1:32894576-32894598 GCTCCATTTGGCTGCATGCAGGG - Exonic
910717346 1:90246720-90246742 GCTCCATTTAACTACAAGAAGGG - Intergenic
911701064 1:100952119-100952141 GTTCCATTGGGCTAAAATCAAGG - Intronic
912179665 1:107204576-107204598 CCACCATCTGAATACAATCAAGG + Intronic
921818873 1:219594063-219594085 GCGCCACTTGAATACATTCAAGG + Intergenic
924054085 1:240107766-240107788 GTTCAATTTGACTAGCATCAAGG - Intronic
1066230202 10:33424806-33424828 GCTCCATTTGAAGCCAATCATGG + Intergenic
1066389799 10:34969511-34969533 GCTCCATTTGAGTGGAAGCATGG + Intergenic
1070437065 10:76403781-76403803 GCACCATGTGACTAGAATGAGGG - Intronic
1070486529 10:76937222-76937244 GCTCCATTGGACAAAAACCAGGG - Intronic
1071331760 10:84567494-84567516 TCTCAATTGGACTAAAATCAAGG - Intergenic
1075667848 10:124243729-124243751 GGTCCATTAGGCTACAGTCAAGG - Intergenic
1083082403 11:60107992-60108014 ACTCCATTTGAGTAGAAGCATGG - Intergenic
1085022906 11:73220149-73220171 GCTCCATGTCACTACAAAGAAGG + Intronic
1091208086 11:133834249-133834271 GCTCCATTTAACTACACAAATGG + Intergenic
1093257893 12:16893987-16894009 CCTCCTTTTGACAAAAATCATGG - Intergenic
1095594076 12:43938955-43938977 GCTCCATTGCACTCCAGTCAGGG + Intronic
1095604751 12:44053207-44053229 GCTCAATTTGACTATAAATATGG + Intronic
1099334830 12:81342041-81342063 GTTCCATTTTACTACCATGATGG + Intronic
1099858138 12:88195328-88195350 GCGCCATTTGAATATAGTCAGGG + Exonic
1108458972 13:50646100-50646122 GCTCAATAGGACTACAGTCATGG - Intronic
1110897723 13:80776375-80776397 GCTTCATGTGACTCCAATAATGG + Intergenic
1120650114 14:87122192-87122214 GTTTCATTTGACTACAAACAAGG + Intergenic
1125089684 15:35775574-35775596 GCTCCTATTGACTGCAACCAAGG - Intergenic
1134366468 16:13583646-13583668 GCTCCATGTGCTTACAATCCAGG + Intergenic
1136950007 16:34705239-34705261 ATTCCATTCGACTACATTCAAGG + Intergenic
1137004867 16:35266435-35266457 GTTTTATTTGACTAAAATCAAGG + Intergenic
1138546909 16:57725176-57725198 GGTCCTTTTCACTAGAATCAGGG + Intronic
1141304345 16:82847304-82847326 GCTTCACTGGACTAAAATCAAGG + Intronic
1141328558 16:83086039-83086061 GCTCCAATTGAGAACAAACAAGG + Intronic
1141488787 16:84357977-84357999 GTTGCATTTGATTACCATCAGGG + Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1144220315 17:13093886-13093908 CCTCCATTTGCCTAAAAGCAGGG + Intergenic
1147696436 17:42358289-42358311 CCTCCATGGGACTACAAGCATGG - Intronic
1150118080 17:62572701-62572723 GCTCCCTTAGACTAGAATAAAGG + Intronic
1152919164 17:83057203-83057225 GCTCCAGCTGACAACAAGCAGGG - Intergenic
1153365255 18:4248568-4248590 GCTCGCTTTGTCTACAGTCATGG - Intronic
1160884486 19:1339202-1339224 CCTCCATTTGAGTTCAAACATGG + Intergenic
1165269346 19:34691658-34691680 ATTCTATTTGACTACAAACATGG + Intergenic
925643637 2:6012064-6012086 GCTCCATGTGGCTGCAATTAAGG + Intergenic
927405254 2:22758931-22758953 GCTGCATTTGACCACATTCTGGG - Intergenic
932544203 2:72690180-72690202 GCATCATTTGACTACCATCTTGG + Intronic
933586125 2:84181198-84181220 GCTCAATTTGACTAAGATTATGG + Intergenic
939259365 2:139787417-139787439 GCTCCATTTGTCAGCACTCAGGG - Intergenic
945642781 2:212450577-212450599 GTTTCATTAGACTAAAATCAAGG - Intronic
946964270 2:225020992-225021014 GGGCCAGTTGACAACAATCAAGG + Intronic
1169018615 20:2311735-2311757 GCTCCAGTTGACTACAGACAGGG - Intronic
1175973525 20:62699048-62699070 GCTCCATTTGACTCCAGGAATGG + Intergenic
1176095435 20:63341756-63341778 GCTCCATTTGATTACATATAAGG - Intergenic
1178611877 21:34089779-34089801 GCACCATTTGAGTCCAATCAGGG + Intronic
1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG + Intronic
1185211883 22:49575163-49575185 GCTCCATTTCACAGCAATCTTGG - Intronic
951383300 3:22012544-22012566 TCTTCATTAGACTACAATCTAGG - Intronic
952615314 3:35264117-35264139 GCTCCACATGAGTACAATCCAGG + Intergenic
955136413 3:56223119-56223141 GCTACATTTGTCTACAGACATGG - Intronic
957988458 3:87600390-87600412 ACTACATTTGACTTGAATCATGG + Intergenic
962096228 3:132295726-132295748 GCTCCATTTGAGTAGAAGCGTGG + Intergenic
965565582 3:170113213-170113235 GCACCATTTGACTAAAATAATGG - Intronic
966982526 3:185152110-185152132 TCTCAATTTGGGTACAATCAAGG + Intronic
967441073 3:189509698-189509720 GTTCCTTTTGAATACAAGCAGGG - Intergenic
973042623 4:45490963-45490985 GCTTCATGTGACTACCATAACGG + Intergenic
979475584 4:121153720-121153742 ACACCAGTTAACTACAATCATGG + Intronic
983833455 4:172360373-172360395 GGTACATATGACTAAAATCAAGG - Intronic
991008593 5:61857446-61857468 TCTGTATTTGACTACAAACATGG - Intergenic
994719147 5:103360830-103360852 GCTCAATTTAACTACAAAGAAGG + Intergenic
1001252455 5:170157357-170157379 GCTCCATCAGACTACAAACTAGG - Intergenic
1003418237 6:5932472-5932494 GCCTCATTGGGCTACAATCAAGG + Intergenic
1017357438 6:153526077-153526099 CCTCCATTTGGCTGCCATCATGG - Intergenic
1019667783 7:2260740-2260762 GCTCAATTTCACTACAACCAAGG + Intronic
1023803704 7:43856220-43856242 GCTTCACTGGACTAAAATCAAGG - Intergenic
1025483652 7:61018849-61018871 ATTCCATTTGATTACATTCAAGG + Intergenic
1026369514 7:69684517-69684539 GCGCCATTTCCCTACAGTCAGGG - Intronic
1032763705 7:134970215-134970237 GATCCATTTCACTCCAATGACGG - Intronic
1038566777 8:28626127-28626149 GCACCATTGCACTACAATCTGGG + Intronic
1041590550 8:59576817-59576839 GGTCCATTAGATTACAATGAAGG + Intergenic
1043550851 8:81371124-81371146 GGTCCATTTGAGAACAATAAAGG + Intergenic
1045837813 8:106543920-106543942 GCTCCATTTAAATTCCATCAAGG - Intronic
1046548258 8:115679228-115679250 GCTCCATATGAAGACGATCAAGG + Intronic
1047906495 8:129478766-129478788 GCTTCATTTGACTACCAGAAAGG + Intergenic
1061858451 9:133455762-133455784 CCTCCCTTTTACTACTATCAAGG + Intronic
1195617571 X:106924895-106924917 GCTCCATATGACTAAAATATAGG - Intronic
1198621530 X:138517332-138517354 GCTTCACTTGACTAAAATCAAGG + Intergenic
1199751996 X:150828651-150828673 GCTCCATTTGACTACAATCAGGG + Intronic