ID: 1199753271

View in Genome Browser
Species Human (GRCh38)
Location X:150841342-150841364
Sequence GGAAGTTTACACAGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199753268_1199753271 -8 Left 1199753268 X:150841327-150841349 CCATAAACATCTTCTGGAAGTTT 0: 1
1: 0
2: 0
3: 19
4: 277
Right 1199753271 X:150841342-150841364 GGAAGTTTACACAGGGAAACTGG 0: 1
1: 0
2: 0
3: 22
4: 222
1199753265_1199753271 22 Left 1199753265 X:150841297-150841319 CCATTTGCGTGTCTGTATCCATA 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1199753271 X:150841342-150841364 GGAAGTTTACACAGGGAAACTGG 0: 1
1: 0
2: 0
3: 22
4: 222
1199753266_1199753271 4 Left 1199753266 X:150841315-150841337 CCATATCTATATCCATAAACATC 0: 1
1: 0
2: 3
3: 54
4: 448
Right 1199753271 X:150841342-150841364 GGAAGTTTACACAGGGAAACTGG 0: 1
1: 0
2: 0
3: 22
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199753271 Original CRISPR GGAAGTTTACACAGGGAAAC TGG Intronic
907672622 1:56490080-56490102 GGATGCTTACACAGGGTCACAGG + Intergenic
908029657 1:59986263-59986285 GGAAGTTGACAAAGGGTAAATGG - Intergenic
908034397 1:60036269-60036291 TGAAGTTATCACAGTGAAACAGG + Intronic
910196794 1:84650431-84650453 GTAAGTTTAGACATGCAAACTGG + Exonic
910302361 1:85720890-85720912 GGAAGTATACTGAGGTAAACTGG + Intergenic
914219182 1:145662845-145662867 GGAAGTTTAAAAAAGGAAAAAGG - Intronic
915595301 1:156893593-156893615 GGAAGTTTTGACAAGGAAACAGG - Intergenic
917104633 1:171480154-171480176 GGAAGATCACAAAGGGAAAGGGG - Intergenic
917730592 1:177871099-177871121 GGAAGTTTACTCATGGGAGCTGG - Intergenic
918590689 1:186237757-186237779 GGAAGTTTACACAGCTTAAAAGG + Intergenic
918771255 1:188563552-188563574 AGAAGTTTCCAGAGAGAAACAGG + Intergenic
919407289 1:197201186-197201208 GGGCGTTTTCCCAGGGAAACTGG - Intergenic
920614168 1:207472966-207472988 GAAAGTTTACACAGGGGAGCAGG - Exonic
920748078 1:208647754-208647776 GGAAAATTACACAGGGCAAGAGG - Intergenic
920764404 1:208817989-208818011 GGATATTGACACAGGGAAACAGG - Intergenic
924254291 1:242166807-242166829 GGAAGTTAACTTAGGGAAAATGG + Intronic
1063351165 10:5356730-5356752 GGAAGATTACTCAGGGACATTGG + Intergenic
1065249634 10:23797620-23797642 GCACGTTTTCACAGGGCAACAGG + Intronic
1065264613 10:23961908-23961930 GGAAATTTAGACACAGAAACAGG - Intronic
1067779240 10:49187245-49187267 ATCAGTTTACACATGGAAACGGG - Intronic
1068396509 10:56468827-56468849 GGAGGATTGCACAGGTAAACAGG - Intergenic
1068858200 10:61819101-61819123 GGAAGTTTATACATGGACACAGG - Intergenic
1070316984 10:75323109-75323131 AGAAGGCTACACAGGAAAACAGG - Intergenic
1070613644 10:77952049-77952071 GCAAGTTTCCAAAGGGAAAGGGG - Intergenic
1071113933 10:82194914-82194936 GGAAGTTTTCAAAGGAGAACAGG - Intronic
1071945604 10:90640911-90640933 GGAATTTAACACAGGCATACTGG - Intergenic
1074596527 10:114872950-114872972 GGAAATTTATACAGGGAATTGGG + Intronic
1075198322 10:120380062-120380084 GGAGGTTTACACAGAGTCACTGG + Intergenic
1075634396 10:124020376-124020398 GGAAGATGCCACAGGGACACAGG - Intronic
1078030691 11:7748312-7748334 AGAGGTATAAACAGGGAAACAGG - Intergenic
1079585092 11:22116024-22116046 GGAAGTTTGTAAAGGCAAACTGG + Intergenic
1080615137 11:33939205-33939227 GTAAGTTTACACATAGAACCAGG + Intergenic
1082742165 11:56923076-56923098 GGAAGATTACATTGGAAAACTGG - Intergenic
1084981042 11:72828937-72828959 GGATGTGGACACCGGGAAACTGG + Exonic
1085303715 11:75473487-75473509 GGAGGTATACACAGGGATGCAGG - Intronic
1085732214 11:79009767-79009789 GAAAGCTTACACTGGGAAGCAGG - Intronic
1088531205 11:110811741-110811763 GGAAGTTTATAAAGGAAAAGAGG + Intergenic
1089119625 11:116124579-116124601 GGGAGTTTGGACAGGGAAACAGG - Intergenic
1091387822 12:105821-105843 GGAAAATTACACAAGGAAATTGG - Intronic
1094418824 12:30248117-30248139 GGAACTTTCCAAAGGGATACAGG + Intergenic
1094731357 12:33179872-33179894 GGGAGTTTGCACAGGGGAAGGGG - Intergenic
1095399956 12:41802628-41802650 GGAGGATTTCACAAGGAAACTGG - Intergenic
1096483582 12:51960121-51960143 GGAAGTTTACACACAGAGACCGG + Intronic
1098036248 12:66305042-66305064 AGAACTTTCCACAAGGAAACTGG + Exonic
1098040688 12:66351527-66351549 GGGAGTATATGCAGGGAAACAGG + Intronic
1100266206 12:92978722-92978744 GCAAGTGTACACAGGTAAAGTGG - Intergenic
1100425046 12:94476600-94476622 GGGCATTTACACTGGGAAACGGG - Intergenic
1100733969 12:97506345-97506367 GGAATTTCACATAGGGAAAGAGG - Intergenic
1101139020 12:101775969-101775991 GGAAGTTTTCAAAGAGAAAGAGG - Intronic
1103251590 12:119504620-119504642 GGAAGTGTACACATGGAATTTGG + Intronic
1103651804 12:122438686-122438708 TGAGGTTTACACAGGGATGCAGG - Intergenic
1104610069 12:130220425-130220447 AGAAGCTTAAACGGGGAAACAGG - Intergenic
1105225575 13:18428435-18428457 AGCAGATTACATAGGGAAACAGG + Intergenic
1105307535 13:19179715-19179737 GTAAGTTTTCACAGGGATAAAGG - Intronic
1105908810 13:24841102-24841124 GGTACTTTGCACAGGGAAATTGG - Intronic
1106798581 13:33232866-33232888 GGAGGTTTATACAGGAAAACAGG - Intronic
1109996550 13:70134749-70134771 GGAAATCAACACAGGGCAACTGG + Intergenic
1112737844 13:102441290-102441312 GGAAGTGTACAAAATGAAACTGG - Intergenic
1112743527 13:102501830-102501852 GGAAGTTTCCAAAGGCAAATTGG + Intergenic
1115691301 14:35846744-35846766 GTAAGTTTACCTGGGGAAACTGG - Intronic
1116047900 14:39766453-39766475 GGAATTTTACACTGGGCTACCGG + Intergenic
1121162176 14:91753966-91753988 GGAAATTTACTCAGGCAAAATGG - Intronic
1121628077 14:95401394-95401416 GGAAGTTTAAATATGGAAATTGG + Intergenic
1123129648 14:105974765-105974787 GGAAGGTTCCACATGGAGACAGG - Intergenic
1123931275 15:25172848-25172870 CGAAGCCCACACAGGGAAACTGG - Intergenic
1124580826 15:30953381-30953403 GGAAGCTGACACTGGGACACTGG - Intronic
1125466451 15:39957752-39957774 GGAAGATGACACAGGGAAAGTGG + Intronic
1126255065 15:46615867-46615889 GGCTATTTACACAAGGAAACGGG + Intergenic
1127217390 15:56838184-56838206 GGAAGTTTAAAAGTGGAAACTGG - Intronic
1127991540 15:64122449-64122471 TGAAGATTACACAGGAATACAGG - Intronic
1128655194 15:69455773-69455795 TCAAGTTTACACAGGTAACCTGG - Exonic
1129084339 15:73072772-73072794 GGTAGTTTACAGAGGTAAATTGG + Intronic
1130118339 15:81024987-81025009 GGAAGGGGACACAGGGAAAGCGG - Intronic
1131199398 15:90384264-90384286 CTAAGTTTACACATGGAATCAGG + Intergenic
1131312544 15:91304066-91304088 GGAGGTATCCACAGGGAAAATGG + Intergenic
1131636355 15:94236917-94236939 GGAAGATTACACAGGTGACCAGG + Intronic
1132789039 16:1674834-1674856 GGAAGCTTGCAAAGGGACACAGG - Exonic
1133879129 16:9764069-9764091 GGAAGTTTTCACTGGGATCCTGG + Exonic
1134139043 16:11700993-11701015 GAGAGTTTACAAAGGGAAACTGG + Intronic
1134272211 16:12742886-12742908 GGACGAATACACAGGGAACCAGG + Intronic
1137887528 16:52122589-52122611 GGCAGTTTACACAGGGCCCCAGG - Intergenic
1138209999 16:55155506-55155528 CGAAGTTCACACAGCAAAACTGG - Intergenic
1139577986 16:67854478-67854500 GGGGGCTTACAGAGGGAAACAGG + Intronic
1141410774 16:83831500-83831522 GGAAGATTCCAGAGTGAAACTGG + Intergenic
1144425384 17:15136502-15136524 GGAATTTTTCACAGGGCAAGTGG - Intergenic
1146463192 17:33064433-33064455 TGAAGATTACCCAGGCAAACAGG - Intronic
1146707596 17:35012694-35012716 GGAAGTTTCCTCAGGAAACCTGG - Intronic
1146920349 17:36705871-36705893 GGGAGTATACAAAGGGAAGCTGG - Intergenic
1147492146 17:40879577-40879599 GGAAGATTTCACAGGGAAAGTGG - Intronic
1148539407 17:48467875-48467897 TGAAGTTTTTATAGGGAAACAGG + Intergenic
1150710957 17:67530448-67530470 GGAAACTTAGACAGGGACACAGG - Intronic
1150837603 17:68578646-68578668 GGAAGTTTAGACAGGTAGCCAGG + Intronic
1151355896 17:73558299-73558321 GGAAGGTTCCACAGGAAATCTGG - Intronic
1151424500 17:74022031-74022053 GGAAGTGTACAATGGGCAACGGG + Intergenic
1153162755 18:2227480-2227502 GCAAGTTCTCCCAGGGAAACAGG + Intergenic
1154010497 18:10569838-10569860 GGTTTGTTACACAGGGAAACTGG + Intergenic
1154136936 18:11787997-11788019 GGAAGTTTGCAGAAGGAAATGGG - Intronic
1154169474 18:12040205-12040227 GGAAGTATGGAGAGGGAAACTGG - Intergenic
1156252813 18:35367649-35367671 GTAATTTTAAACAGGGAATCTGG + Exonic
1156400565 18:36736017-36736039 GGAAGTTATCACATTGAAACAGG + Intronic
1157081286 18:44528189-44528211 TGAAGTTTACAGAGAAAAACAGG - Intergenic
1157278701 18:46331639-46331661 GCAAGGTTGCACAGAGAAACTGG + Intronic
1158980175 18:62752302-62752324 GGGAGTTGACACAGAGAAGCAGG + Intronic
1162041111 19:7971586-7971608 GGGAGTTTACACCGAGTAACTGG + Intronic
1164642119 19:29833657-29833679 TGAAGTTTCCAGAGGGAAAGAGG - Intergenic
924976648 2:182907-182929 AGAAGTTTTCAAAAGGAAACAGG - Intergenic
925783303 2:7403728-7403750 GGTAGTTTACAAAGGGAGAGAGG + Intergenic
926596904 2:14800452-14800474 GGTAATTTATACAGGGAAAAGGG - Intergenic
928274741 2:29890300-29890322 GGAAGTTTCCAGAGTCAAACAGG + Intronic
928582943 2:32726795-32726817 GGTAATTTACATAGGAAAACGGG + Intronic
928667641 2:33566572-33566594 ATTAGTTTACACAGGGAGACAGG + Intergenic
928917842 2:36492305-36492327 AGAAGTGTACAAAGGGAAAAAGG + Intronic
929190602 2:39136057-39136079 AGAAGGTGACACAGAGAAACAGG - Intergenic
931571770 2:63676213-63676235 GAAAGTTTACAAAGGGGAGCCGG + Intronic
934513667 2:94969769-94969791 AGAAGATTCCACATGGAAACAGG + Intergenic
934681565 2:96287369-96287391 GGAAGACTACATAGGCAAACTGG + Intronic
940793192 2:158049466-158049488 AGAAGTTTAAAAAGGAAAACAGG - Intronic
941838271 2:170050439-170050461 GGAAGAGCACACAGGTAAACAGG - Intronic
942270979 2:174274749-174274771 GGAATTTTACATAAGAAAACAGG + Intergenic
943559130 2:189440672-189440694 GTAAGTTTACAAAGGAAAACTGG + Intergenic
945279283 2:208020147-208020169 GTAAGTATTCACAGGTAAACTGG + Intronic
945337229 2:208606626-208606648 GGAAGTTTAGACATGGATGCAGG + Intronic
945414473 2:209554064-209554086 AGTAGTTTACACTGTGAAACAGG - Intronic
946070243 2:217028843-217028865 GTAAGTCTTCACAGAGAAACTGG + Intergenic
946341906 2:219075034-219075056 GGAGGTTTACAGTGGGAGACTGG + Intergenic
946714535 2:222539404-222539426 GGAATTTTATACAGGGAATGTGG + Intronic
1168918514 20:1511565-1511587 GACAGATTACACAGGGATACTGG - Intergenic
1169284409 20:4295851-4295873 GGAAAACTACACAGGAAAACTGG + Intergenic
1170319156 20:15075661-15075683 AGGAGTTTACTCAGGGCAACTGG - Intronic
1170438105 20:16350741-16350763 GGAAGTTTACAAAGGGCACACGG + Intronic
1170585806 20:17732996-17733018 GGAAGATGCCACAGGGAGACAGG + Intronic
1171162282 20:22938738-22938760 GGAAATACCCACAGGGAAACAGG + Intergenic
1171429461 20:25072008-25072030 AGAAGTTTGCACTGGAAAACAGG + Intronic
1172782274 20:37443892-37443914 GGCAGTTTTCTCTGGGAAACAGG + Intergenic
1173004442 20:39128951-39128973 GGAGGTTTAAAGAGGGAAAATGG - Intergenic
1174225932 20:49000039-49000061 GGGTGTTTACACACAGAAACTGG - Intronic
1174944005 20:54964599-54964621 GGAAGATGAGACAGGGAAAATGG + Intergenic
1176769629 21:13057458-13057480 AGCAGATTACATAGGGAAACAGG + Intergenic
1177883520 21:26721768-26721790 GGTAACTTACACAGGGATACAGG - Intergenic
1178186476 21:30227732-30227754 GGAAGTGGACATAGCGAAACTGG + Intergenic
1178368846 21:32010328-32010350 GGTTGTTGGCACAGGGAAACTGG + Intronic
1181378314 22:22478527-22478549 GGAAGTTACCACAGGGAAAATGG - Intergenic
1181878463 22:25958492-25958514 GGAAGTTTCCACTGGGAGAAGGG + Intronic
1181993720 22:26858351-26858373 AGAAGTTTGCACAGAGAAGCTGG + Intergenic
1183781720 22:40003205-40003227 GGCAGGTAACACAGGGAAGCTGG + Intronic
1184427267 22:44418391-44418413 GTAAGTTTACAGTGAGAAACCGG - Intergenic
1184684503 22:46090047-46090069 GGAAATTTCCCCAGGGAAAGGGG + Intronic
1203288817 22_KI270735v1_random:14762-14784 GGTATTTTACAAAGGGAAATAGG - Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
951393074 3:22130598-22130620 TGAAGTTTTCACTGGGAAATTGG - Intronic
951554655 3:23909069-23909091 GTAAGTTTTCACAGGGCAAAAGG + Intronic
952280850 3:31921907-31921929 GGAAGATCACAGAGGGAAAGTGG - Intronic
952289532 3:32002053-32002075 GGCAGTTTAAACTGGGAATCTGG - Intronic
952325281 3:32314993-32315015 GGAAGTATGAACAGGGAAACAGG - Intronic
953175006 3:40542887-40542909 GGAAAATAACAGAGGGAAACAGG - Intronic
953818838 3:46186601-46186623 GAATATTTACACAGGGAAATTGG - Intronic
957954245 3:87163377-87163399 GGAAGCTTTCAAAGGGAAAAGGG - Intergenic
959222467 3:103538879-103538901 GTAAGTTTAGACATGCAAACTGG + Intergenic
961740865 3:129032564-129032586 GGGACTTTACACAGGGACATGGG - Intronic
962367712 3:134796915-134796937 GGGAGTTTCCACTGGGCAACCGG - Intronic
963748563 3:149150514-149150536 GGAGGGTTTCACAGGCAAACAGG - Intronic
965347963 3:167575546-167575568 AGAACTTTCCACAGGGATACCGG + Intronic
965480896 3:169218448-169218470 GGAAGTTTACAAGGAAAAACAGG + Intronic
965560689 3:170059727-170059749 GGTTTGTTACACAGGGAAACGGG + Intronic
966912579 3:184567679-184567701 CCAAGTCTATACAGGGAAACTGG + Intronic
968316157 3:197727394-197727416 GGAAGTTCACAGGGGGAAAATGG - Intronic
971814974 4:31476020-31476042 GGCAATTTACACAGGAAAAAGGG + Intergenic
972140978 4:35958552-35958574 GGTAATTTATACAGGAAAACGGG - Intronic
972828568 4:42788256-42788278 GGAAATGTACACTGGGAAAAGGG + Intergenic
973787053 4:54341985-54342007 GGAAATATACTCAGGGATACTGG + Intergenic
975913871 4:79299392-79299414 GGAAGTTTACAGAGGCTATCAGG + Intronic
976688098 4:87838267-87838289 AGAAGTTTTCACTGGCAAACTGG - Intronic
978398472 4:108307322-108307344 GCAAGTTTAGAAAGAGAAACTGG + Intergenic
978992189 4:115098000-115098022 GCAATTTTGCACCGGGAAACCGG - Intronic
980668810 4:135975331-135975353 GGGAGTGCACATAGGGAAACAGG - Intergenic
980843840 4:138300324-138300346 GGGAGTCTTAACAGGGAAACAGG - Intergenic
982321944 4:154086153-154086175 AAAGGTTTACACAGGGAAAGAGG - Intergenic
982677840 4:158396492-158396514 GGATGATTACACAGGGGCACAGG - Intronic
982786969 4:159547470-159547492 GTAACTTTACACTGAGAAACAGG - Intergenic
984341591 4:178464133-178464155 GGATGTTTATACAGGGAGAGAGG + Intergenic
987300782 5:16596429-16596451 GGAAGCTGACAAGGGGAAACTGG + Intronic
987727242 5:21717990-21718012 GGAAACTTACAAGGGGAAACAGG + Intergenic
988026630 5:25701853-25701875 GGAACTTTACAGGGGGAAAGGGG - Intergenic
988369884 5:30354867-30354889 GAAAGGGTACACCGGGAAACTGG - Intergenic
990169107 5:53028121-53028143 GGAAGTTCACACAGAAAAAAAGG - Intronic
991024084 5:62011167-62011189 AGGAGTATACACAGGGAAGCAGG + Intergenic
992407124 5:76470183-76470205 GGAAACTTACACATGGCAACTGG + Intronic
993456334 5:88131376-88131398 TTAAGGTTACACAGGGCAACGGG + Intergenic
995921199 5:117315288-117315310 GGAAGGTTACACAGGCAAGGGGG + Intergenic
996891736 5:128428593-128428615 GGAATTTTAAACAGGCAACCAGG - Intronic
1000250932 5:159494670-159494692 ACAAGTTTACACAGTGGAACTGG + Intergenic
1000329330 5:160194803-160194825 GGAGGTATAGGCAGGGAAACCGG - Intronic
1002071810 5:176683097-176683119 GGAACTTTCCAGAGGGAAACGGG - Intergenic
1002194160 5:177493256-177493278 GGCAGTGTTCACAGGGAACCGGG - Intronic
1003503066 6:6718222-6718244 GAAAGTTTCCACAGTGAGACTGG - Intergenic
1011041613 6:83035612-83035634 TGAAGTTTGCAGAGGGAAAAAGG - Intronic
1011618120 6:89216575-89216597 GGGAGCTTACACAGGAAACCAGG - Intronic
1012340584 6:98117451-98117473 GGAAGTTTAGGTAGGAAAACAGG + Intergenic
1013589936 6:111611417-111611439 GGTAATTTATACAGGGAAAAGGG + Intergenic
1014231466 6:118907458-118907480 GGAAGATAACACAGAAAAACTGG + Exonic
1014634459 6:123828109-123828131 GGAAGTCTTCACAGGGGAAATGG - Intronic
1015440906 6:133244175-133244197 GGAAATTTACAAAGGAAAACAGG - Intronic
1017074930 6:150609285-150609307 AGAAAATTACACAGGGAAATGGG + Intronic
1017651471 6:156587061-156587083 GAAAGAATACACAGGGTAACAGG + Intergenic
1018455409 6:163947373-163947395 GGAAGTTTCCACTGGCAAACAGG + Intergenic
1021583581 7:22183640-22183662 TGCAGTTTACACAGGAAAACCGG + Intronic
1022312913 7:29214135-29214157 GGAAGTCTAAAAAGGGAAATCGG - Intronic
1023105424 7:36759187-36759209 TCAAGTTTACATAGGGACACTGG + Intergenic
1025611663 7:63080211-63080233 AGAAGTTGACACAGGGAAGGAGG + Intergenic
1028379930 7:90188613-90188635 GGAAGTTTCTACTGGGAAAGAGG + Intronic
1030656643 7:112175211-112175233 TGAAGTTTAAACAGTGAAAAAGG + Intronic
1031085175 7:117295577-117295599 AGCAGTTTGCACAGGGAAGCAGG - Intronic
1033044440 7:137948560-137948582 GCAAGTTAACAGAAGGAAACAGG + Intronic
1033246503 7:139720911-139720933 GGAATTTTACAGAGGGGAAGAGG + Intronic
1036274595 8:7339336-7339358 GGAAGTGGACACCGTGAAACAGG - Intergenic
1036346757 8:7971010-7971032 GGAAGTGGACACCGTGAAACAGG + Intergenic
1036466689 8:9004139-9004161 GGAAGTGCACACAGGGCAAAAGG - Intronic
1036842085 8:12131764-12131786 GGAAGTGGACACCGTGAAACAGG + Intergenic
1036863914 8:12378014-12378036 GGAAGTGGACACCGTGAAACAGG + Intergenic
1037671124 8:21016169-21016191 GGAGGTTCTAACAGGGAAACAGG + Intergenic
1041716392 8:60936234-60936256 GGAAGTTTCCAAAAGGAAAAGGG - Intergenic
1042490906 8:69396327-69396349 GTAATTTTCAACAGGGAAACAGG + Intergenic
1044408744 8:91861281-91861303 GGAAGTGATCTCAGGGAAACAGG + Intergenic
1044654788 8:94536161-94536183 GTTAGACTACACAGGGAAACTGG + Intronic
1049184118 8:141240349-141240371 GGAAGTATACTCAGGGGAAAAGG - Intronic
1049692881 8:143970324-143970346 GGAAGTATACAAAGAAAAACGGG + Intronic
1052935806 9:34092286-34092308 GGAAGTTTACAAAGGGCATGAGG - Intronic
1055312486 9:74997429-74997451 GGAATTGTACTCAGAGAAACAGG - Intronic
1055718550 9:79145758-79145780 GGAAGTTTGCACAGAAAAAGAGG + Intergenic
1058011018 9:99977218-99977240 GCAAGTTTATACAGGGCACCAGG + Intergenic
1058874853 9:109235315-109235337 CTAAGTTTACAAAGGGAAAGGGG - Intronic
1061089221 9:128417507-128417529 GGCAGGGGACACAGGGAAACAGG + Intronic
1186620995 X:11240158-11240180 GTAAGTTTACATAGGAAAACAGG + Intronic
1191780975 X:64865123-64865145 AGAAGACCACACAGGGAAACAGG - Intergenic
1193482270 X:82042979-82043001 GGTAGTTTACACAGGAAAAGGGG - Intergenic
1194369761 X:93058234-93058256 GGAGATTTACATAGGGAAACAGG + Intergenic
1194767009 X:97853353-97853375 AGAAGTTTACACAGGTATTCTGG + Intergenic
1195751664 X:108165561-108165583 GGAAGCTCACACAGAGAAAATGG + Intronic
1197023585 X:121719009-121719031 GGAAATTTACACAGGTAAAAGGG + Intergenic
1198800359 X:140441313-140441335 TGAAGTTTACTGAGGGAATCAGG + Intergenic
1198924198 X:141769577-141769599 GGCAGTTGACACAGGGCAATTGG + Intergenic
1199668132 X:150118436-150118458 GAAAGTTTACCCAGGGACTCTGG + Intergenic
1199753271 X:150841342-150841364 GGAAGTTTACACAGGGAAACTGG + Intronic
1200677950 Y:6174444-6174466 GGAGATTTACATAGGGAAACAGG + Intergenic
1200736830 Y:6808311-6808333 GAAAGTTTACAAAAGAAAACTGG - Intergenic