ID: 1199754707

View in Genome Browser
Species Human (GRCh38)
Location X:150853391-150853413
Sequence CAGTGAAGTGGGTGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1134
Summary {0: 1, 1: 1, 2: 14, 3: 119, 4: 999}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199754707 Original CRISPR CAGTGAAGTGGGTGGGTGGG GGG (reversed) Intronic
900291468 1:1925470-1925492 CAGGGCAGGGGGTGGGTGGTGGG + Intronic
900406622 1:2495704-2495726 CAGTGAAGTGGTAGGGAGTGTGG + Intronic
900598783 1:3494269-3494291 CAGTGAAGTGGTGGGGAGGTGGG - Intronic
900649964 1:3725852-3725874 GGATGGAGTGGGTGGGTGGGTGG + Intronic
900650022 1:3726043-3726065 GGATGGAGTGGGTGGGTGGGTGG + Intronic
900754772 1:4425990-4426012 CAGGGAAGTGGGTGGGGCCGTGG - Intergenic
901110576 1:6790287-6790309 TGGTGAAGAGGGTGGGAGGGTGG + Intronic
901205535 1:7493635-7493657 CAGGGAACTGGGGGGGGGGGGGG + Intronic
901379355 1:8862685-8862707 CGCTGCAGTGGGTGGGTAGGGGG + Intronic
901425173 1:9178060-9178082 CAGGGCAGGGGGTGGCTGGGTGG + Intergenic
901873369 1:12151722-12151744 CAGTGAAGTGGGGCAGTGGCGGG + Intergenic
902234404 1:15048363-15048385 CAGAGAAGTTGCTGTGTGGGTGG - Intronic
902248023 1:15134527-15134549 GAGTGAGGTGAGTGGGAGGGGGG + Intergenic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
902487699 1:16759498-16759520 AAGTGAGGTGGGCGGGGGGGCGG - Intronic
902509980 1:16961150-16961172 CAGGGAAGGGGGGAGGTGGGCGG + Intronic
902579371 1:17398668-17398690 CACTTCTGTGGGTGGGTGGGTGG - Exonic
902933055 1:19744981-19745003 CAGAGAGGTGGATGGGTGGATGG + Intronic
902933071 1:19745041-19745063 CAGACAGGTGGGTGGGTGGATGG + Intronic
902933125 1:19745277-19745299 CAGGTAAAAGGGTGGGTGGGTGG + Intronic
902974649 1:20080151-20080173 CAGTGTGGTGGGTGGGAGGGAGG + Intronic
903269506 1:22178616-22178638 CTGTTGGGTGGGTGGGTGGGTGG - Intergenic
903338377 1:22639421-22639443 CAGAGAGGTGGGTGGGGGAGGGG - Exonic
903378979 1:22883970-22883992 CAGTGAGGTGGGTGGGTGGGGGG - Intronic
903950086 1:26991587-26991609 CAGTGAAGAGGAAGGGTGGAGGG - Intergenic
904175855 1:28628216-28628238 CGGTGCAGGGGGTGGGGGGGGGG + Intronic
904250653 1:29221756-29221778 CTGTGAGTTGGCTGGGTGGGTGG + Intronic
904285054 1:29448694-29448716 CAGAGAAGGGGGAGGCTGGGCGG - Intergenic
904364175 1:29999903-29999925 CAGTGATCTGGAAGGGTGGGAGG + Intergenic
904373277 1:30064392-30064414 CTCTGCAGTGTGTGGGTGGGAGG + Intergenic
904754717 1:32761803-32761825 AAGAAGAGTGGGTGGGTGGGTGG + Intronic
905225124 1:36473777-36473799 GAGTGAAGCTGGTGGGTAGGTGG + Exonic
905789593 1:40783215-40783237 CAGTGCTGTGTGTGGCTGGGTGG - Intergenic
906155865 1:43613628-43613650 CGGTGATGGGGATGGGTGGGTGG - Exonic
906190236 1:43894237-43894259 CAGTGAACAGGCTGGGTGGAGGG + Intronic
906253295 1:44328223-44328245 CAGTGCATTGCGGGGGTGGGGGG - Intronic
906514360 1:46430142-46430164 CAGTGAAGAGGCTGAGTTGGAGG + Intergenic
906684068 1:47751714-47751736 AAATCAAGTGGCTGGGTGGGTGG + Intergenic
906785085 1:48608536-48608558 CAGAGAAGTGGATGGATGGATGG + Intronic
906789122 1:48643329-48643351 CAGCTAAGTGGGTAGGTGGAGGG - Intronic
906888162 1:49675418-49675440 AAGTGAGGAGGGTGGGAGGGAGG + Intronic
907311473 1:53541388-53541410 CAATCATGTGGGTGGCTGGGTGG - Intronic
907412028 1:54289810-54289832 CAGGGTAGGGGGTGGGTGTGGGG + Intronic
907427799 1:54391875-54391897 GATTGAGGTGGGTGGGTGGAGGG - Intronic
907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG + Intronic
907525348 1:55050686-55050708 TAGCATAGTGGGTGGGTGGGAGG + Intronic
907567451 1:55449094-55449116 TTAAGAAGTGGGTGGGTGGGAGG - Intergenic
908149184 1:61282172-61282194 CATTGAAGTGGGGGTGGGGGCGG - Intronic
908268158 1:62398300-62398322 GAGTGGGGTGGGTGGGTGGGTGG - Intergenic
908759960 1:67502490-67502512 GGCTGAGGTGGGTGGGTGGGTGG + Intergenic
908812940 1:68002752-68002774 CAGAGAAGAGGTTTGGTGGGAGG - Intergenic
909055630 1:70817295-70817317 GAGGGAAATGGGTGGGTGGGAGG + Intergenic
909363348 1:74791035-74791057 ATGTGAAGCGGGTGTGTGGGAGG + Intergenic
909519568 1:76551834-76551856 CTGTGAAGTGTGTGTGTGGTGGG - Intronic
909593827 1:77381977-77381999 CTGTGCAGAGGGTGGGTGGAGGG - Intronic
909607620 1:77522587-77522609 CAGGGAGGTGGGATGGTGGGAGG - Intronic
909747465 1:79115615-79115637 CAGTGAGGAGAATGGGTGGGAGG + Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911454669 1:98108283-98108305 CAGTAAAGTGGGAGGATGGAAGG + Intergenic
912713601 1:111966572-111966594 GAGTGAAGTCCGTCGGTGGGTGG - Intronic
912865207 1:113250373-113250395 AACTGAAGTGGGTGGGTGATGGG + Intergenic
913166543 1:116192359-116192381 CAGTGAACAGGGTAGGTGAGAGG + Intergenic
913237544 1:116797807-116797829 CAGTGAAGTGGGGGAGGCGGAGG - Intergenic
913337116 1:117718600-117718622 TAGTGGGGTGGGAGGGTGGGAGG - Intergenic
913386003 1:118259120-118259142 CAGTGAAGTGTGTTGGAAGGAGG - Intergenic
913522600 1:119659953-119659975 CAGTGAGGTTGTTGGGAGGGAGG - Intronic
914732613 1:150385169-150385191 TAGTGAAGTGGCTGGATGTGCGG + Intronic
915058311 1:153157914-153157936 CAGAGAGGGGGGTGGGAGGGGGG + Intergenic
915147673 1:153805017-153805039 CCCTGAATAGGGTGGGTGGGAGG - Exonic
915177839 1:154031520-154031542 AAGCGTAGTGGGTGGGTGGGAGG - Intronic
915179633 1:154047101-154047123 AAGGGCAGTGGGTGGGTAGGGGG + Intronic
915369424 1:155335895-155335917 CATTGCAGGGAGTGGGTGGGAGG - Intronic
915653067 1:157333778-157333800 GAGTGATGGGGGTGGGCGGGTGG - Intergenic
915915351 1:159937386-159937408 CAGGGAAGTGGGTGGGAGAGAGG - Intronic
916050407 1:161032291-161032313 TATTGAAGTGGGTGGGGGTGAGG - Intronic
916097507 1:161364214-161364236 CATGGTAGTGGGTGGGTGGGGGG + Exonic
916102609 1:161406082-161406104 CGGTGCAGCGGGTGGGGGGGGGG + Intergenic
916611597 1:166397076-166397098 CTGTGAAGTGGGTGGCTCAGAGG + Intergenic
916846137 1:168652101-168652123 CACTGCAGTGGGTGGGCAGGAGG - Intergenic
917127436 1:171699758-171699780 CAGTTTAGTGTGTGGGTGGAGGG + Intergenic
917216151 1:172680306-172680328 CAGAGAAGTGGGAGGAAGGGAGG - Intergenic
917285118 1:173415303-173415325 GAGGCAAGTGAGTGGGTGGGAGG + Intergenic
917678489 1:177342199-177342221 CAGGGAAGTGGGTGGGTGTCAGG - Intergenic
918319969 1:183355056-183355078 CAGTGCAGTGGGTGGGCCAGGGG - Intronic
919519726 1:198572909-198572931 GAGAGGAGTAGGTGGGTGGGAGG + Intergenic
919934954 1:202245292-202245314 CTCTGAGGTGGGTGGGTGGGCGG + Intronic
920051550 1:203167635-203167657 CAGGGAGGTGGGGGGATGGGGGG - Intergenic
920074624 1:203327311-203327333 GAGGGACGTGGGTGGGTGGCTGG - Intergenic
920111883 1:203592616-203592638 CAGGGAAGTTGGGGGCTGGGAGG + Intergenic
920540457 1:206774131-206774153 GCGTGAAGTGAGTGGGAGGGAGG + Intergenic
920553803 1:206889076-206889098 CAGTATGCTGGGTGGGTGGGAGG - Intergenic
921409753 1:214823255-214823277 CAGTGGAGGTGGTGGGAGGGGGG + Intergenic
922020667 1:221700977-221700999 CAATGGGGTGGGGGGGTGGGGGG + Intergenic
922024267 1:221736379-221736401 CAGGGAAGTTGGTGGGAGGGGGG - Intronic
922392586 1:225161157-225161179 CAGGGTAGTGGGGGAGTGGGAGG - Intronic
922791154 1:228311817-228311839 CTGAGAAGTGGGTGGGAGGGAGG + Intronic
922930099 1:229382180-229382202 CAGTGGAGTGGGCGGCTGGAGGG + Intergenic
922987613 1:229878129-229878151 AAGTGGAGTGGGAGGGAGGGAGG + Intergenic
923455885 1:234164829-234164851 CTGTGATTTGGGTGGGGGGGGGG + Intronic
923635102 1:235687716-235687738 TAGTGAAGTGAGTGTGGGGGAGG - Intronic
924172663 1:241357505-241357527 CTGTGCGATGGGTGGGTGGGTGG + Intergenic
924173237 1:241363110-241363132 CTGTGAAGTGGGTGTGTGTTAGG - Intergenic
924743147 1:246809427-246809449 CATTGAAGTGGGAGGGAGGCAGG + Intergenic
924761584 1:246992398-246992420 AAGGGTAGTGGGTGAGTGGGTGG + Intronic
1063078208 10:2737838-2737860 AAGATAAGTTGGTGGGTGGGTGG + Intergenic
1063335033 10:5203903-5203925 CAGTGAAGAGTGTGGGAGGCAGG + Intronic
1063782277 10:9339043-9339065 CAGTAAAATGGATGGATGGGTGG + Intergenic
1063942714 10:11147097-11147119 CAAGGGAGTGGGTGGGTGGATGG - Intronic
1064148254 10:12842221-12842243 AAAGGAAGGGGGTGGGTGGGGGG + Intergenic
1065780461 10:29162054-29162076 CAGAGAAGGGGGAGGGTGGAGGG - Intergenic
1065830276 10:29608676-29608698 CAGTGATGAGTGTGGGAGGGAGG + Intronic
1065916067 10:30355858-30355880 GAGGAAAGTGGCTGGGTGGGAGG + Intronic
1066011025 10:31193413-31193435 GAGGGAAGTGGCTGGATGGGAGG + Intergenic
1066100628 10:32115101-32115123 CAATGAGGTGGGTGCGAGGGAGG - Intergenic
1066221613 10:33340104-33340126 CATTTCAGTGGGTGGGTGTGGGG + Intergenic
1066336048 10:34479728-34479750 CACTGAAGTGGGTGGAGAGGAGG - Intronic
1067227760 10:44386551-44386573 CAGTGCCCAGGGTGGGTGGGTGG - Intergenic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067557862 10:47284994-47285016 GAGGGAAGGGGGTGGGAGGGAGG + Intergenic
1067616971 10:47763774-47763796 CAGGGGAGTGTGTGTGTGGGGGG + Intergenic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067723577 10:48749402-48749424 AAGTGCAGTGTGTGGGTGTGTGG - Intronic
1068629368 10:59284183-59284205 AAATGAAGAGAGTGGGTGGGAGG - Intronic
1069836432 10:71311320-71311342 CAGGGAAGTGGGAGGGCGGCAGG + Intergenic
1069898525 10:71694116-71694138 GAGAGAAGTGGGTGCGTGAGAGG - Intronic
1070356498 10:75645449-75645471 CAGAGAGGAGGGTGGGTTGGTGG + Intronic
1070416645 10:76196619-76196641 CAGTTAAGTGGGATGGAGGGGGG - Intronic
1070612308 10:77941912-77941934 CCCTGAAGTGAGTGGGTTGGGGG - Intergenic
1070678956 10:78435387-78435409 CAGGGAGTTGGGTGGGTGGAGGG - Intergenic
1070749311 10:78954613-78954635 CTGTCAAGTGGGTGGGTTGGGGG + Intergenic
1070793725 10:79204763-79204785 TAGTTAGATGGGTGGGTGGGTGG + Intronic
1071108603 10:82127838-82127860 CACTGAAGAGGGTGGGAGAGAGG - Intronic
1071306418 10:84302916-84302938 AAGTAAGGGGGGTGGGTGGGGGG - Intergenic
1071775073 10:88777662-88777684 CAGAGATGAGGGTGAGTGGGAGG - Intronic
1071912062 10:90247532-90247554 AAGGAAAGTGGGTGGGTGGGCGG + Intergenic
1072241006 10:93495954-93495976 CAGCGGAGTGGGGGGGGGGGGGG - Intergenic
1072244224 10:93527123-93527145 CAGTGAAGAGGGTGGATAGCAGG - Intronic
1072466605 10:95669123-95669145 CAGAGTAGTGGGGGGGTAGGAGG + Intronic
1072796078 10:98355504-98355526 CAGGGCAGTGGGTGTGTGGCTGG + Intergenic
1073150170 10:101306010-101306032 CAGGGGAGTGGGTTGTTGGGGGG + Intergenic
1073150929 10:101310997-101311019 GACTGAAGTGGGTGGGAGAGAGG - Intergenic
1073559849 10:104487355-104487377 CAGTGAGGAGGGTGGATTGGAGG + Intergenic
1073649527 10:105343747-105343769 CTATGGAATGGGTGGGTGGGTGG - Intergenic
1074175323 10:110994813-110994835 AAGTGATGTGGTGGGGTGGGAGG + Intronic
1074378092 10:112955090-112955112 GGGTGAGGTGGGGGGGTGGGAGG - Intronic
1074383818 10:113001438-113001460 CAGAGAAGTGGCTGGCTGGCTGG + Intronic
1074397102 10:113107246-113107268 CTGGGTACTGGGTGGGTGGGTGG + Intronic
1074937209 10:118193421-118193443 CAGTGAAATGTGTGTGTGTGTGG - Intergenic
1075065301 10:119285326-119285348 GAGTACAGTGGGAGGGTGGGTGG + Intronic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076278178 10:129223803-129223825 GAGTTAATTGGGTGGGTGGGTGG + Intergenic
1076725147 10:132409641-132409663 TAGAGGTGTGGGTGGGTGGGTGG - Intronic
1076761950 10:132610351-132610373 CAGTGATGGGGGTGGGGGGTGGG + Intronic
1076837512 10:133028558-133028580 TAGATAAATGGGTGGGTGGGTGG + Intergenic
1076855488 10:133113742-133113764 CAAGGATGGGGGTGGGTGGGAGG + Intronic
1076867637 10:133175863-133175885 CAGTTAAGTGGATGGATGGGTGG + Intronic
1076902643 10:133347531-133347553 CAGGGGAGTGTGCGGGTGGGAGG + Intronic
1077130859 11:971759-971781 CAGTGAAGTGAGTGGGACCGGGG + Intronic
1077130889 11:971930-971952 CAGTGCCCTGGGTGCGTGGGTGG + Intronic
1077248533 11:1550692-1550714 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248550 11:1550757-1550779 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077248567 11:1550818-1550840 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248601 11:1550936-1550958 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248618 11:1551001-1551023 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077248636 11:1551062-1551084 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248656 11:1551131-1551153 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077248674 11:1551196-1551218 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077248709 11:1551318-1551340 GAGTGGGGTGGGCGGGTGGGTGG - Intergenic
1077248727 11:1551379-1551401 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248746 11:1551444-1551466 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077248775 11:1551557-1551579 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248792 11:1551614-1551636 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248811 11:1551679-1551701 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077248863 11:1551862-1551884 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077275574 11:1705777-1705799 CAGTGTGGTGGGTGGGGGGCTGG + Intergenic
1077311919 11:1892629-1892651 CAGACAAATGGGTGGATGGGTGG + Intergenic
1077357634 11:2126053-2126075 GAGGTAAGTGGGTGAGTGGGTGG + Intergenic
1077359613 11:2134883-2134905 AAGTGCAGTTGGTGGGTGGCAGG - Intronic
1077383439 11:2258064-2258086 CAGGGAGATGGGTGGGTGGAGGG - Intergenic
1077402532 11:2366302-2366324 GGGTGGAGTGGGTGGGTGGTGGG - Intergenic
1077504224 11:2922685-2922707 GAGTGGAGTGGGTGGGGTGGGGG + Intronic
1077699571 11:4428954-4428976 CAGTGAAATGGCTGGGTCAGAGG - Intergenic
1077868508 11:6241980-6242002 CAGTGAACAGGGTGGGTTCGTGG + Intronic
1078356401 11:10635271-10635293 CAGTCAAGGGGGTGGGAAGGAGG - Intronic
1078630765 11:13001752-13001774 CAGTGAACTGGGTGGTGCGGGGG - Intergenic
1079060611 11:17245641-17245663 TAGTTAAGAGGGTGGGTTGGAGG + Intronic
1079074040 11:17372475-17372497 CAGTAAAGTTGGGGGTTGGGAGG - Exonic
1079227066 11:18615763-18615785 CAGTGAAGTTCATGGGTGGTGGG + Exonic
1079281529 11:19091074-19091096 GAGTGGAGTGGGTGGGGTGGGGG - Intergenic
1080226354 11:29965529-29965551 CCGTGAAGTGGGTGGGTGTGGGG - Intergenic
1080334079 11:31175461-31175483 CTGTGTAGTGGGTGTGTGTGTGG - Intronic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1080406211 11:31981711-31981733 CAGTGAAAAGGGAGGGTGTGGGG + Intronic
1080749278 11:35138130-35138152 CAGATATGTGGGTGGATGGGTGG + Intergenic
1081280804 11:41207571-41207593 CAGTGGAGGAGATGGGTGGGAGG - Intronic
1081618654 11:44605437-44605459 CAGTGAAGAGGGAGGGAGAGAGG - Intronic
1081693961 11:45096665-45096687 CAGTGAAGAGGCTGCTTGGGAGG - Intronic
1081706581 11:45185482-45185504 GAGTGAGGTGGGAGGGTGTGTGG + Intronic
1082074832 11:47968171-47968193 GGCTGAGGTGGGTGGGTGGGTGG - Intergenic
1083172172 11:60929482-60929504 GGGTGAACTGGGTAGGTGGGTGG - Intronic
1083547239 11:63558169-63558191 CAGTGCAGTGGGTTGGGGGGTGG - Intronic
1084047643 11:66579261-66579283 GAGTGCAGTGGCTGCGTGGGAGG - Intergenic
1084166056 11:67375177-67375199 CACTGAGGTGGGGGGGTGGGGGG + Intronic
1084425809 11:69084051-69084073 CACTGGAGTGGGAGGCTGGGAGG + Intronic
1084456702 11:69271883-69271905 AAGTTAAGTGGGTGAGTGGATGG - Intergenic
1084699392 11:70776692-70776714 CAGTTAGGTGGGTAGGTGGGAGG - Intronic
1085416900 11:76324638-76324660 CTGGAAAGTGGGTGGGTCGGAGG + Intergenic
1085732761 11:79013440-79013462 CAGTGAAGGGGGTTGGGGGAAGG - Intronic
1085800397 11:79584237-79584259 CAGTGCAGTGGGTGGGGGCCAGG + Intergenic
1086123451 11:83326023-83326045 CAGTGAGTTGGGTGAGTGGATGG + Intergenic
1086511682 11:87565323-87565345 CAATGAAGGGGGTGGGGGAGAGG - Intergenic
1086870767 11:92033886-92033908 GGGTGAAGTGGGGAGGTGGGGGG - Intergenic
1086933997 11:92724072-92724094 CAGTGTTGTGGGTGGGTTGTTGG + Intronic
1087250438 11:95893076-95893098 GAGTGAGGAGGATGGGTGGGTGG - Intronic
1087363604 11:97192101-97192123 CTCTGAAAAGGGTGGGTGGGAGG - Intergenic
1087503667 11:98993340-98993362 CAGTGGGTTGGATGGGTGGGTGG + Intergenic
1087853370 11:103059741-103059763 CCGAGGAGTGGGGGGGTGGGGGG + Intergenic
1087942430 11:104115043-104115065 CAGGGAAGAGGGTGGGGAGGGGG - Intronic
1087981244 11:104617323-104617345 CAGTGAAGAGTGTGGCAGGGTGG - Intergenic
1088100668 11:106152197-106152219 CAGTGATGTGGGCAGGTTGGAGG - Intergenic
1088642125 11:111882714-111882736 CAGTGAAGTGGTTGGGGCAGAGG + Intronic
1088920390 11:114256691-114256713 CAGGGGAGGGGATGGGTGGGAGG + Intergenic
1089399579 11:118156687-118156709 CTGTGAGGTGGGTGTGTGTGGGG - Intergenic
1089612796 11:119678811-119678833 CAGGGAACTGTGTGGGTGGGGGG - Intronic
1089695212 11:120212239-120212261 CAGCCCGGTGGGTGGGTGGGTGG + Intronic
1090305645 11:125688799-125688821 CAGGGCAGTGGCTGGGAGGGAGG + Intergenic
1090739094 11:129640916-129640938 CTGTGAAATGAGTGAGTGGGAGG + Intergenic
1091781221 12:3215702-3215724 CTGGGAAGTGTGGGGGTGGGAGG + Intronic
1091837129 12:3593999-3594021 CTGTGAAGTGGGAGGGCTGGGGG + Intergenic
1092449516 12:8588927-8588949 TAGTGAATACGGTGGGTGGGGGG - Intergenic
1092857469 12:12688162-12688184 CAGTGAAGAGAGTGGGAGGGGGG + Intronic
1094538832 12:31345925-31345947 CTGAGAAGTGGCTGGGTTGGGGG + Intergenic
1094818922 12:34210099-34210121 CTGTGGTGTGGGTGGGTGTGGGG + Intergenic
1095940408 12:47723296-47723318 CAGTGGAGTGCAGGGGTGGGAGG + Intronic
1096252229 12:50040647-50040669 CAGAGGTGTGGGAGGGTGGGTGG - Intergenic
1096325768 12:50659905-50659927 CAGAGATGTGGGGAGGTGGGTGG - Intronic
1096524598 12:52202895-52202917 CTGTGGTGTGTGTGGGTGGGGGG + Intergenic
1096585282 12:52615832-52615854 GAGAGCAGCGGGTGGGTGGGGGG + Intronic
1096766249 12:53892723-53892745 CAGGGCAGTGGGTGGGAGGTAGG + Intergenic
1097021063 12:56021139-56021161 CAGTGAAGGGGGTGGGTGGTGGG - Intronic
1097959737 12:65520723-65520745 CAGAGAAGTGGTTGGGCTGGGGG - Intergenic
1097984400 12:65768343-65768365 GAGTGAAGTGGGTGGTGGTGGGG + Intergenic
1098014624 12:66091455-66091477 AGGTGAGGTGGGAGGGTGGGAGG - Intergenic
1098653990 12:73006517-73006539 GAGAGAAGGGGTTGGGTGGGGGG + Intergenic
1099260107 12:80368384-80368406 CAGTGCAGTGTGTGTGGGGGGGG - Intronic
1100938576 12:99699151-99699173 GTGTGAAGTGGGTGGCAGGGGGG - Intronic
1100981647 12:100166960-100166982 CAGGGAGGTGGGTGGATGGAGGG - Intergenic
1101007555 12:100415843-100415865 GAGTGAAGTGGCTGGGAGTGTGG + Intronic
1101048086 12:100831764-100831786 CAGCTAAGTGGCTGGGTGGCAGG - Intronic
1101270046 12:103133331-103133353 TAGTGGACTGGGTAGGTGGGTGG - Intergenic
1101785953 12:107883770-107883792 TAGTGCAATGTGTGGGTGGGGGG + Intergenic
1101971450 12:109316158-109316180 GATTGATTTGGGTGGGTGGGGGG + Intergenic
1103201880 12:119094509-119094531 CAGTGAAGGTGGAGGGTGGCAGG - Intronic
1103379702 12:120484338-120484360 TACAGATGTGGGTGGGTGGGTGG + Intronic
1103744777 12:123115071-123115093 CAGGGAGGTGGGCGGGTGAGAGG - Intronic
1104187128 12:126443716-126443738 AAGTGGAGAGGGTGTGTGGGAGG + Intergenic
1104381598 12:128312449-128312471 CAGTCAGGTGTGTTGGTGGGCGG - Intronic
1104519668 12:129461718-129461740 TAGAGAGGTGGGTGGGTGGGTGG + Intronic
1104614587 12:130257104-130257126 CAGTGCAGTGGGTGGCTGAAGGG + Intergenic
1104841297 12:131827345-131827367 CAGGGAAGCGGGGGGGGGGGGGG + Intergenic
1104880425 12:132067062-132067084 CGCTCAAGTGGGTGGGTGTGAGG - Intronic
1104954424 12:132457468-132457490 CGGGGGAGTGGGTGGGTGGGTGG + Intergenic
1104954530 12:132457778-132457800 CAGGTGAGTGGGTGGGTGGGTGG + Intergenic
1105007356 12:132729571-132729593 GAGGGGAGTGGATGGGTGGGAGG + Intronic
1105042335 12:132970254-132970276 GAGTGGAGTTGGTGGATGGGTGG + Intergenic
1105318446 13:19291030-19291052 CAGAGAAATGGGTACGTGGGAGG + Intergenic
1105431200 13:20339414-20339436 CAGACAAGTGTGTAGGTGGGAGG - Intergenic
1105946966 13:25198385-25198407 GGGAGAACTGGGTGGGTGGGAGG + Intergenic
1106047334 13:26155449-26155471 CAGTGAAGTGGGGTGGAGGATGG + Intronic
1107318434 13:39159625-39159647 CAATGAAGTGTGTGGGTGGTGGG + Intergenic
1107561097 13:41558328-41558350 CAGATAAATGAGTGGGTGGGTGG - Intergenic
1108096685 13:46909106-46909128 AAGTGAGGAGGGTGGGAGGGTGG - Intergenic
1108925113 13:55732739-55732761 CTCTGCAGTGGGTGGGGGGGGGG + Intergenic
1109267688 13:60219931-60219953 AAGTGAAGGGGGTGGGTGGGAGG + Intergenic
1109462358 13:62678391-62678413 CAGAGGAGCGGGTGTGTGGGAGG - Intergenic
1110082406 13:71331949-71331971 CAGTCATGGGGTTGGGTGGGGGG + Intergenic
1110281508 13:73699186-73699208 GATTGCAGTGGGGGGGTGGGGGG - Intronic
1111128966 13:83949630-83949652 CAGAGACATGTGTGGGTGGGTGG + Intergenic
1111287445 13:86113475-86113497 CAGTGGTGTTGGTGGTTGGGAGG - Intergenic
1111479794 13:88809894-88809916 CAGTGTTGGAGGTGGGTGGGAGG + Intergenic
1111675610 13:91384745-91384767 GAGAGAAGTGGTGGGGTGGGGGG + Intergenic
1111781734 13:92736405-92736427 TAATGAAGAAGGTGGGTGGGGGG - Intronic
1111784165 13:92766285-92766307 TGGTGGTGTGGGTGGGTGGGTGG - Intronic
1112151493 13:96769448-96769470 CAGGAATGTGGGGGGGTGGGGGG - Intronic
1112286750 13:98111525-98111547 CAGTGCAGTATGTGGGTGAGAGG - Intergenic
1113182312 13:107643530-107643552 CAGTGTATTTGGTGGGGGGGGGG + Intronic
1113532298 13:111037163-111037185 CAGTGAGGTGGGGAAGTGGGGGG + Intergenic
1113643613 13:111976334-111976356 CACCAAAGCGGGTGGGTGGGTGG + Intergenic
1113927368 13:113949206-113949228 CAGTGAAGAGAGTGGGGAGGTGG - Intergenic
1114155595 14:20099506-20099528 CAGGGGAGCGGGTGAGTGGGGGG - Intergenic
1114160847 14:20165378-20165400 CAGCGTATTGGGTGGGTGAGTGG + Intergenic
1114517467 14:23309043-23309065 AAGTGGAGTTGGTGGATGGGTGG + Exonic
1114728398 14:24964121-24964143 AAATGAAGTGTCTGGGTGGGGGG - Intronic
1114743218 14:25119397-25119419 CTTTGATCTGGGTGGGTGGGAGG + Intergenic
1115985776 14:39102853-39102875 GAGCGAAGTGGGTGAGAGGGTGG + Intronic
1117031748 14:51678831-51678853 TTTTGGAGTGGGTGGGTGGGTGG + Intronic
1117252153 14:53948727-53948749 CAGGGAAGAGGGTGTGAGGGAGG + Intergenic
1117252269 14:53949931-53949953 CTGTGTAGTGTGTGGGTGAGTGG + Exonic
1117272817 14:54162608-54162630 GAGAGAAGTGGGTGGGGAGGGGG - Intergenic
1117627102 14:57651372-57651394 GAGTGAAGTGGGTCGGTGGTGGG + Intronic
1118346602 14:64945740-64945762 CAGTGATGTGGGAGGGAGAGAGG - Intronic
1118480184 14:66156828-66156850 TACTCAAGTGGGGGGGTGGGAGG - Intergenic
1118764558 14:68901101-68901123 CAGGGGAGGGAGTGGGTGGGAGG + Intronic
1118956566 14:70488500-70488522 CAGTGGACTGGGTTGGTGGCAGG + Intergenic
1119054352 14:71403987-71404009 CTGTGATGTGGGTGGGTGGGTGG - Intronic
1119162111 14:72461254-72461276 CAGTGGAGAGGGTGGGAGGATGG + Intronic
1119222479 14:72920323-72920345 TAGATAGGTGGGTGGGTGGGTGG - Intergenic
1119616021 14:76099586-76099608 GAGCGAGGTGGCTGGGTGGGAGG + Intergenic
1119616663 14:76103311-76103333 CAGGGAGGAGGCTGGGTGGGGGG - Intergenic
1119648548 14:76366812-76366834 TGTTGAAGTAGGTGGGTGGGTGG + Intronic
1120184092 14:81374467-81374489 CAGCAAAGTGTGTGGGTGGGTGG + Intronic
1120216972 14:81690672-81690694 GAGTCAAGTGGGTGGGTTAGGGG + Intergenic
1120678661 14:87452835-87452857 CAGTGAAGTGGGTGGTGGGTTGG - Intergenic
1120698573 14:87672312-87672334 TAGTGGAGGGGGTGGGTGAGGGG + Intergenic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121424066 14:93835685-93835707 CCCTGTAGTGGGTGGGTGGGTGG + Intergenic
1121567754 14:94923501-94923523 CAGTGAAGGTGGAGGGGGGGAGG - Intergenic
1121630050 14:95415286-95415308 CAGAGCAGTGGCAGGGTGGGTGG - Intronic
1122059594 14:99127941-99127963 CTGTAATGGGGGTGGGTGGGGGG - Intergenic
1122138377 14:99647436-99647458 CAGTGAGGTGGGCAGGTGGATGG + Intronic
1122651343 14:103228764-103228786 CAGGGGAGGGGGTGGGAGGGAGG + Intergenic
1122799947 14:104224509-104224531 CAGAGAGGGGTGTGGGTGGGGGG + Intergenic
1122976574 14:105173331-105173353 GAGTGGAGAGGGTGGGTTGGAGG - Intronic
1202835182 14_GL000009v2_random:72511-72533 CAGTGAGGGGTGTGGGTGGTAGG + Intergenic
1123440273 15:20285894-20285916 CAGGGAAGTGGGGGAGGGGGAGG + Intergenic
1123633033 15:22275138-22275160 TAGGTGAGTGGGTGGGTGGGTGG - Intergenic
1123633087 15:22275308-22275330 GGGTGAATAGGGTGGGTGGGTGG - Intergenic
1123666319 15:22611608-22611630 CAGGGAGGTGGGTGGATGGAAGG - Intergenic
1123733279 15:23163512-23163534 CAGCGAGGTGGGTGGATGGAAGG + Intergenic
1123751413 15:23360887-23360909 CAGCGAGGTGGGTGGATGGAAGG + Intronic
1124201402 15:27681461-27681483 CAGTGCAGCGGGTGGGAGGAGGG - Intergenic
1124283783 15:28384805-28384827 CAGCGAGGTGGGTGGATGGAAGG + Intronic
1124298914 15:28526808-28526830 CAGCGAGGTGGGTGGATGGAAGG - Intronic
1124320138 15:28706022-28706044 CAGGGAGGTGGGTGGATGGAAGG - Intronic
1124482374 15:30089395-30089417 CAGGGAGGTGGGTGGATGGAAGG + Intronic
1124488832 15:30141497-30141519 CAGGGAGGTGGGTGGATGGAAGG + Intronic
1124521203 15:30407814-30407836 CAGGGAGGTGGGTGGATGGAAGG - Intronic
1124537457 15:30558406-30558428 CAGGGAGGTGGGTGGATGGAAGG + Intronic
1124543915 15:30610461-30610483 CAGGGAGGTGGGTGGATGGAAGG + Intronic
1124563876 15:30797894-30797916 CAGGGAGGTGGGTGGATGGAAGG + Intergenic
1124594821 15:31083658-31083680 CAGTGGAGCGAGGGGGTGGGAGG - Intronic
1124656777 15:31515610-31515632 AAGAGAGATGGGTGGGTGGGTGG - Intronic
1124656804 15:31515749-31515771 CAGTTGTGTGGGTGGGTGGGTGG - Intronic
1124761199 15:32449181-32449203 CAGGGAGGTGGGTGGATGGAAGG - Intronic
1124777435 15:32599882-32599904 CAGGGAGGTGGGTGGATGGAAGG + Intronic
1124839743 15:33230565-33230587 CAGTGAAGGGGTGGGGGGGGGGG - Intergenic
1124839748 15:33230570-33230592 CAGTGCAGTGAAGGGGTGGGGGG - Intergenic
1124959383 15:34383347-34383369 CAGGGAGGTGGGTGGATGGCAGG - Intronic
1124976009 15:34529568-34529590 CAGGGAGGTGGGTGGATGGCAGG - Intronic
1125497901 15:40214835-40214857 CACTTAATTGGGTGGGTGGGGGG - Intronic
1126034016 15:44530750-44530772 AAATAGAGTGGGTGGGTGGGAGG + Intergenic
1126035732 15:44543884-44543906 CAGTGATATGGGTGGGGTGGGGG + Intronic
1126490253 15:49229312-49229334 CAGTGAGCTGGGTGAGTGGCTGG + Intronic
1126667580 15:51089239-51089261 TAGGTAGGTGGGTGGGTGGGCGG - Intronic
1127226459 15:56935622-56935644 CAGGGAAAAGGGTGGGAGGGCGG - Intronic
1127637919 15:60888908-60888930 CCGAGGAGTGGGAGGGTGGGTGG + Intronic
1127658582 15:61078791-61078813 TAGGTAGGTGGGTGGGTGGGTGG - Intronic
1127826536 15:62708805-62708827 CTGTGCTGTGGGTGGGTGGATGG + Intronic
1127855740 15:62952272-62952294 CAGAATAGTGGGGGGGTGGGGGG + Intergenic
1128157588 15:65401597-65401619 GAGTGCAGAGAGTGGGTGGGAGG + Intronic
1128318195 15:66674571-66674593 CAGTGCAGGGGATGGGTTGGAGG - Intronic
1128339161 15:66808453-66808475 CAGCGACGTGGGATGGTGGGAGG - Intergenic
1128339242 15:66808817-66808839 CAGTGAAGTCTGTGGGGCGGAGG + Intergenic
1128726559 15:69992290-69992312 CAGAGGAGAGAGTGGGTGGGAGG - Intergenic
1128755762 15:70182607-70182629 GAGAGAAAGGGGTGGGTGGGTGG + Intergenic
1129037880 15:72661918-72661940 CAGGGAGGTGGGTGGGTGGAAGG + Intronic
1129157889 15:73730172-73730194 CAGTGATGAGGGTGGGTCAGAGG + Intergenic
1129212009 15:74075309-74075331 CAGGGAGGTGGGTGGGTGGAAGG - Intronic
1129398394 15:75265776-75265798 CAGGGAGGTGGGTGGGTGGAAGG + Intronic
1129402002 15:75290051-75290073 CAGGGAGGTGGGTGGGTGGAAGG + Intronic
1129466828 15:75728756-75728778 CAGCAAAGAGGCTGGGTGGGAGG + Intergenic
1129729135 15:77919630-77919652 CAGGGAGGTGGGTGGGTGGAAGG - Intergenic
1129839370 15:78734319-78734341 CAGGGAGGTGGGTGGATGGAAGG + Intergenic
1129901879 15:79157657-79157679 CAGTGGGGTGGAGGGGTGGGGGG + Intergenic
1129922313 15:79329769-79329791 AAGGGGAGTGGGTGGATGGGTGG - Intronic
1130251702 15:82304228-82304250 CATTGCCCTGGGTGGGTGGGTGG + Intergenic
1130259729 15:82345715-82345737 CAGGGAGGTGGGTGGATGGAAGG - Intronic
1130268990 15:82433721-82433743 CAGGGAGGTGGGTGGATGGAAGG + Intronic
1130281504 15:82523294-82523316 CAGGGAGGTGGGTGGATGGAAGG + Intergenic
1130361071 15:83186729-83186751 AAGGGAAGAGGGTGGGAGGGGGG + Intronic
1130429335 15:83830954-83830976 TTGCCAAGTGGGTGGGTGGGTGG + Intronic
1130472877 15:84239477-84239499 CAGGGAGGTGGGTGGATGGAAGG + Intronic
1130480368 15:84354048-84354070 CAGGGAGGTGGGTGGATGGAAGG + Intergenic
1130491401 15:84434081-84434103 CAGGGAGGTGGGTGGATGGAAGG - Intergenic
1130503017 15:84513121-84513143 CAGGGAGGTGGGTGGATGGAAGG - Intergenic
1130595171 15:85244111-85244133 CAGGGAGGTGGGTGGATGGAAGG + Intergenic
1130908740 15:88256944-88256966 CCGGCGAGTGGGTGGGTGGGTGG - Intergenic
1130959371 15:88649580-88649602 GAGAGATGTGGGTGTGTGGGCGG - Intronic
1131106786 15:89740308-89740330 CATTGTAGTGGGTCGCTGGGAGG + Intronic
1131423377 15:92326086-92326108 CAGTGATGGGGGATGGTGGGTGG + Intergenic
1132406145 15:101542834-101542856 CAGTGCTGGGGTTGGGTGGGGGG - Intergenic
1132406158 15:101542870-101542892 CAGTGCTGGGGTTGGGTGGGGGG - Intergenic
1132439281 15:101842376-101842398 CAGTGCTGTGGGTGGTCGGGGGG + Intergenic
1132590428 16:724045-724067 TGGGGCAGTGGGTGGGTGGGGGG + Intronic
1132663444 16:1071481-1071503 CACTGCTGTGGGAGGGTGGGAGG + Intergenic
1132761110 16:1509057-1509079 CACTGATGGGGCTGGGTGGGCGG + Intronic
1133021394 16:2968524-2968546 CAGACAGATGGGTGGGTGGGTGG + Intronic
1133036088 16:3035183-3035205 CACTGGACGGGGTGGGTGGGTGG - Intronic
1133416654 16:5612289-5612311 TGGGAAAGTGGGTGGGTGGGTGG - Intergenic
1133462722 16:6000890-6000912 TAGGTAGGTGGGTGGGTGGGCGG + Intergenic
1133739534 16:8640803-8640825 AAGATAGGTGGGTGGGTGGGTGG + Intronic
1134112515 16:11524180-11524202 GAGGGTAGTGGGTGGGTGGATGG - Intergenic
1134224801 16:12381649-12381671 GGGTGGGGTGGGTGGGTGGGTGG - Intronic
1135380697 16:21993989-21994011 CAATGGAGGTGGTGGGTGGGTGG - Intronic
1136133783 16:28241734-28241756 CATTGCGGTGGGTGGGGGGGGGG - Intergenic
1136272963 16:29159238-29159260 CAGTGGGGTGGGGGGGTGGTGGG + Intergenic
1136500436 16:30667409-30667431 CAGTGAAGAGGGAGGCCGGGTGG - Exonic
1136544684 16:30948573-30948595 CAGGGAGGTGCGCGGGTGGGGGG + Exonic
1136932437 16:34431711-34431733 CGGGGAAGCGGGTGGGGGGGCGG - Intergenic
1136972135 16:34980103-34980125 CGGGGAAGCGGGTGGGGGGGCGG + Intergenic
1137614936 16:49840874-49840896 CAGGGAAGCGGCTGTGTGGGAGG - Intronic
1137771553 16:51019889-51019911 GAGTGGAGTGCTTGGGTGGGAGG - Intergenic
1137808251 16:51328483-51328505 CAGGGGAGATGGTGGGTGGGGGG - Intergenic
1137957946 16:52852327-52852349 CAGTGGGCTGGATGGGTGGGTGG + Intergenic
1138396755 16:56710377-56710399 CAGTGGTGAGGGTGGCTGGGAGG - Intronic
1138836846 16:60447841-60447863 CAGTGAAGTTGGTATGTGGAAGG + Intergenic
1139161668 16:64517463-64517485 GAGGGAAGTGGGTGGATGGAGGG + Intergenic
1139467079 16:67159813-67159835 TAGTGCAGCAGGTGGGTGGGTGG - Intronic
1139587509 16:67913584-67913606 CTGTGAAGTGAGTGGCTGGAAGG + Intronic
1139587825 16:67915688-67915710 CTGTGAAGTGAGTGGCTGGAAGG - Intronic
1139875867 16:70145508-70145530 CAGTTAGGTGGGAAGGTGGGAGG - Intronic
1139933917 16:70553339-70553361 CCTTCATGTGGGTGGGTGGGTGG + Intronic
1140067700 16:71625433-71625455 CAGGTGAGTGGGTGAGTGGGCGG + Intergenic
1140326100 16:74005121-74005143 AAGTGGTGTGGGTGGGTGGGTGG + Intergenic
1140359920 16:74335590-74335612 CAGTTAGGTGGGAAGGTGGGAGG + Intergenic
1140408628 16:74727509-74727531 CACTGAAGCAGGAGGGTGGGTGG - Intronic
1140864923 16:79051562-79051584 CTGTGTGCTGGGTGGGTGGGAGG + Intronic
1140974479 16:80045722-80045744 CAGTGAAGAGGGTGGGGAAGAGG + Intergenic
1141173384 16:81704569-81704591 CAGGGAGGAGGGTGAGTGGGTGG - Intronic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141430200 16:83967474-83967496 GAGGGAGGGGGGTGGGTGGGTGG + Intergenic
1141430202 16:83967478-83967500 GAGGGGGGTGGGTGGGTGGGTGG + Intergenic
1141646763 16:85371721-85371743 CAGTGAGCTGGGAGGATGGGAGG - Intergenic
1141690935 16:85595852-85595874 TAGAAAAGTGGGTGGGTGGATGG - Intergenic
1141690958 16:85595932-85595954 CGGAGGAATGGGTGGGTGGGTGG - Intergenic
1141898295 16:86972627-86972649 TGGGTAAGTGGGTGGGTGGGTGG + Intergenic
1141925238 16:87164152-87164174 CACTGAGGTGGGTGGCTGGCGGG - Intronic
1141935874 16:87237286-87237308 GAAGGAAGTGGGCGGGTGGGGGG + Intronic
1142063400 16:88045774-88045796 GAGAGAACTGGATGGGTGGGGGG + Intronic
1142518354 17:447975-447997 CAGTGAATTGTGTGTGTGTGTGG + Intergenic
1142717719 17:1756028-1756050 AAGTGAAGTGGGGGAGGGGGCGG + Intergenic
1142931418 17:3287234-3287256 CAGAAATGTGGGTGGGTAGGAGG - Intergenic
1143216527 17:5229234-5229256 CAGTGAAGAGGGCGTGTGAGTGG + Intronic
1143299701 17:5900315-5900337 TAGTGACATTGGTGGGTGGGTGG + Intronic
1143329347 17:6121967-6121989 CAGGGAGGTGGGAAGGTGGGTGG + Exonic
1143340844 17:6209744-6209766 CAGTGAGGGGTGGGGGTGGGGGG - Intergenic
1143562393 17:7703674-7703696 AAGTCAAGTGGGTGGGGGTGGGG + Intergenic
1143731198 17:8883922-8883944 CAGTGAAGGAGGTGGGCAGGAGG - Intronic
1143763056 17:9118641-9118663 CTGGAAAGGGGGTGGGTGGGAGG - Intronic
1144084842 17:11799221-11799243 CAGATAAGTGGGAGGGTGGCAGG - Intronic
1144742818 17:17593515-17593537 CAGTGAAGTGGATGTGTGGTAGG - Intergenic
1144854769 17:18261662-18261684 CCTTGAAGTGTGTGGCTGGGTGG - Intronic
1145004321 17:19328893-19328915 CAGGAAAGTGGGTGAGTGAGGGG - Intronic
1145840841 17:27993051-27993073 CTGTGATCTGGGTGGGTGGAAGG - Intergenic
1145850862 17:28094642-28094664 CTTTGAGGTGGGTGGGTGGTGGG + Intronic
1145994355 17:29096979-29097001 GAGGGAAGTGGGTGAGTGAGGGG + Intronic
1146168793 17:30616282-30616304 CAGAGAATGGGGTGGGTGGGTGG - Intergenic
1146170769 17:30631166-30631188 CAGAGAATGGGGTGGGTGGGTGG + Intergenic
1146344216 17:32047185-32047207 CAGAGAATGGGGTGGGTGGGTGG + Intronic
1146956641 17:36939921-36939943 CAGTGACCTGTGTGGGCGGGGGG - Intronic
1148005999 17:44430076-44430098 TTATGTAGTGGGTGGGTGGGTGG - Intronic
1148049992 17:44765186-44765208 CATTGCCGGGGGTGGGTGGGGGG + Intronic
1148050002 17:44765211-44765233 CTGGCAGGTGGGTGGGTGGGTGG + Intronic
1148050006 17:44765215-44765237 CAGGTGGGTGGGTGGGTGGGGGG + Intronic
1148322254 17:46764587-46764609 GGGTGAAGTGTGTGGCTGGGCGG - Exonic
1148521381 17:48279151-48279173 CAGAGAAGTGTGTGGGAAGGAGG - Intronic
1148592221 17:48825013-48825035 ACTTGAACTGGGTGGGTGGGGGG - Intergenic
1149243686 17:54680571-54680593 CGTTGCAGTGGGTGGGTGGGCGG - Intergenic
1149272561 17:54996221-54996243 CAGAGAAGTGGCAGGGTGGATGG + Intronic
1149549153 17:57527265-57527287 CTGGGGTGTGGGTGGGTGGGTGG - Intronic
1149738683 17:59021626-59021648 GAGTGTAGTGGGTGGCTGGGGGG + Intronic
1150767222 17:68011724-68011746 CAGTGAAGAGGCTGGGCGCGGGG - Intergenic
1150781745 17:68128822-68128844 CAGAGAATGGGGTGGGTGGGTGG - Intergenic
1151202353 17:72477930-72477952 CAGTGAAGGTGCTGGGTCGGTGG - Intergenic
1151360633 17:73586595-73586617 GACTGCAGGGGGTGGGTGGGTGG + Intronic
1151376487 17:73692310-73692332 CAGGGAAGTGTGTGTGTGGTGGG - Intergenic
1151460202 17:74249802-74249824 CAGCCAGGTGGGGGGGTGGGAGG + Intronic
1151502634 17:74501308-74501330 GAGGGGAGTGGGTGGATGGGTGG + Intergenic
1151537519 17:74747353-74747375 CTTTGAAGTGAGTGGGGGGGGGG + Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151871753 17:76841490-76841512 CACAGACATGGGTGGGTGGGGGG - Intergenic
1152197529 17:78925950-78925972 CAGTTTAGTTGGGGGGTGGGGGG + Intergenic
1152238269 17:79149532-79149554 CTGTGAAGTGGGTGGGGCAGTGG + Intronic
1152317274 17:79588559-79588581 CAGTGAAGGGGGTGTGGGGTGGG - Intergenic
1152422571 17:80202038-80202060 CACTGGAGTCAGTGGGTGGGAGG - Intronic
1152608290 17:81303742-81303764 CAGGAAAGGGGGAGGGTGGGCGG - Intergenic
1152850637 17:82632626-82632648 CACAGAAGTGGGTGGGTGGATGG - Intronic
1153946362 18:10021575-10021597 TAGGTAAGTGGGTGGGTAGGTGG - Intergenic
1154286152 18:13058639-13058661 CAGTGAGGAGGGAGGGTGGCTGG + Intronic
1154377646 18:13823052-13823074 CAGTGGGTTGGGTGGATGGGTGG - Intergenic
1154377856 18:13823849-13823871 TGGTTGAGTGGGTGGGTGGGTGG - Intergenic
1155079861 18:22398058-22398080 AAGTGAAGTGGGTGTGGTGGTGG + Intergenic
1155697688 18:28702160-28702182 CAGGTAAGTGGGTAGGTGGAGGG + Intergenic
1155898599 18:31360423-31360445 AAGGGAAGAGGGTGTGTGGGAGG - Intergenic
1155995831 18:32330684-32330706 CATTTAAATGGGAGGGTGGGAGG + Intronic
1156036840 18:32773582-32773604 CAGTGCTGGGGGTGGGGGGGAGG - Exonic
1156371770 18:36477531-36477553 TAGGTAGGTGGGTGGGTGGGTGG - Intronic
1156465487 18:37345865-37345887 CACTGAAGAGGGTGGGTAGGTGG - Intronic
1156504940 18:37584408-37584430 CAGGTAATTGGGTGGGTGGGAGG + Intergenic
1156672444 18:39486989-39487011 GATGGAAGTGGGTGGGTGGATGG - Intergenic
1157138466 18:45082103-45082125 CAGGGAAGTGGGTGGGGTGGGGG + Intergenic
1157194859 18:45612672-45612694 CAGCTAAGTAGGTGGGTGGTAGG + Intronic
1157492849 18:48136359-48136381 CGCTGAGCTGGGTGGGTGGGGGG - Intronic
1157540912 18:48505822-48505844 CAGTGGAGGTGGTGGGAGGGTGG - Intergenic
1157572850 18:48724376-48724398 GAGTGAAGACAGTGGGTGGGAGG - Intronic
1157714455 18:49873807-49873829 AAGGGAGGTGGCTGGGTGGGAGG + Intronic
1158826584 18:61227108-61227130 CAGGTAAGAGGATGGGTGGGGGG - Intergenic
1159521178 18:69527196-69527218 CAGTGAAGTGGGTGGAGGGTTGG - Intronic
1159971990 18:74666335-74666357 CAGAGAAGTGGGTGGGCCCGAGG + Intronic
1160170043 18:76545258-76545280 CAGGAAAGTGTGTGTGTGGGGGG + Intergenic
1160240396 18:77118586-77118608 CTGTGGAGTGTGTGTGTGGGTGG - Intronic
1160506207 18:79427953-79427975 CTGTGCAGTGGGTGGCGGGGGGG + Intronic
1160632873 18:80258670-80258692 GTGTGGGGTGGGTGGGTGGGGGG + Intergenic
1160692277 19:465580-465602 CAGGCAGGTGGGTGGGTGGATGG + Intronic
1160714635 19:570675-570697 GGGTGGGGTGGGTGGGTGGGGGG + Intergenic
1160717420 19:582612-582634 AGGTGTGGTGGGTGGGTGGGCGG + Intronic
1160741065 19:686072-686094 CAGAGAAGTGGGTGGGGGCTGGG - Intronic
1160774517 19:848818-848840 CAATGAACTGGGTGGGGGGGTGG + Intergenic
1160920713 19:1518972-1518994 AAGTGAAGAGAGTGGGTGAGAGG + Intergenic
1160970582 19:1766180-1766202 AGGTGCTGTGGGTGGGTGGGTGG - Intronic
1161066105 19:2238473-2238495 AGGTGCAGTGGGTGGATGGGAGG - Intronic
1161123009 19:2540504-2540526 CTGTGCAGAGGGTGGGTGCGTGG + Intronic
1161227704 19:3154773-3154795 CGATGAATGGGGTGGGTGGGTGG + Intronic
1161237748 19:3206201-3206223 CAGGCCAGTGGGTGGGTGGGTGG + Intronic
1161287327 19:3475580-3475602 CAGATGAATGGGTGGGTGGGTGG + Intronic
1161287598 19:3477006-3477028 CAGATGAGTGGGTGGGTGGATGG + Intronic
1161347709 19:3776441-3776463 CAGGGGGATGGGTGGGTGGGTGG + Intergenic
1161525222 19:4750582-4750604 AAGGGCAGTGGGTGGGTGAGAGG - Intergenic
1161565584 19:5000178-5000200 TAGATAGGTGGGTGGGTGGGTGG - Intronic
1161591725 19:5131997-5132019 AAGTGACGAGGGTGAGTGGGGGG + Exonic
1161899219 19:7105310-7105332 CAGACAAATGGGTGGGTGGATGG + Intergenic
1161974054 19:7599257-7599279 GAGTGCAGTGGGTAGGTGGGTGG - Intronic
1161974060 19:7599282-7599304 GAGTGGGGTGGGTGGGTGGATGG - Intronic
1161974100 19:7599424-7599446 GAGTGCAGTGGGTAGGTGGGTGG - Intronic
1161974109 19:7599457-7599479 GAGTGGGGTGGGTGGGTGGGTGG - Intronic
1161974160 19:7599640-7599662 GAGTGGGGTGGGTGGGTGGGTGG - Intronic
1162132651 19:8536642-8536664 CAGTCCTGGGGGTGGGTGGGAGG + Intronic
1162320324 19:9967847-9967869 CAGTGAAGGGGGTGGGGAGCTGG + Intronic
1162514197 19:11138485-11138507 AGGACAAGTGGGTGGGTGGGTGG - Intronic
1162522056 19:11186963-11186985 TAGAGAAGAGGGTAGGTGGGTGG + Intronic
1162774358 19:12969982-12970004 CAGGTGAGTGGGTGGGTGTGGGG + Exonic
1162781497 19:13009300-13009322 CTGGGCAGCGGGTGGGTGGGGGG + Intronic
1162977526 19:14217175-14217197 CAGAGATGTGGGGGGGGGGGGGG + Intergenic
1163383448 19:16984157-16984179 GAGTGAAGTTGGTCTGTGGGTGG + Intronic
1163383570 19:16985382-16985404 AAGTGTAGTGGGTGGATGGATGG + Intronic
1163502697 19:17686304-17686326 TAGTGGAGTGGGGGGGGGGGGGG - Intronic
1163528737 19:17837099-17837121 GGGTGGGGTGGGTGGGTGGGGGG + Intronic
1163558766 19:18007043-18007065 CAGTGAGGTGTGTGGGTGGAGGG - Intronic
1163571231 19:18083587-18083609 TGGGAAAGTGGGTGGGTGGGAGG - Intronic
1163671123 19:18629313-18629335 CCTGGTAGTGGGTGGGTGGGTGG + Intergenic
1163704122 19:18802574-18802596 CACTGCAGTCGGTGGGTGGAGGG + Intergenic
1163719953 19:18894240-18894262 GAGTGCGGTGGGTGGGTGGGTGG + Intronic
1163758725 19:19121504-19121526 CAGTTAAGTGGGTCGCTTGGTGG - Exonic
1163760312 19:19132894-19132916 CAGTCCTGTGGGTGGGTGGGGGG - Intronic
1163813177 19:19447430-19447452 CCATGAAGTGGGGGAGTGGGGGG - Intronic
1164573656 19:29392510-29392532 CAGGGAAGTGGGTGGGGAGCAGG + Intergenic
1164576325 19:29407374-29407396 CTGTAGAGTGAGTGGGTGGGTGG + Intergenic
1164685972 19:30167174-30167196 CCGTGTTCTGGGTGGGTGGGTGG + Intergenic
1164816741 19:31209895-31209917 GTGTGGAGTGGTTGGGTGGGGGG + Intergenic
1164891797 19:31829742-31829764 CAGAGGTGTGGGTGGGTGGGGGG - Intergenic
1165168251 19:33872281-33872303 CAGGTAAATGGGTGGATGGGTGG - Intergenic
1165263800 19:34643411-34643433 CTGGGAAGGGTGTGGGTGGGGGG + Intronic
1165349442 19:35268274-35268296 CAGTAAAGTAGGTCGGTGGGGGG - Intergenic
1165777494 19:38413279-38413301 CATTGAAGGGGGAGGGTGGCTGG + Exonic
1165893725 19:39129623-39129645 CAGCCTGGTGGGTGGGTGGGTGG - Intronic
1165998809 19:39865253-39865275 CAGATGGGTGGGTGGGTGGGTGG + Intronic
1166049813 19:40252005-40252027 CAGTGAAGTGGGGGACAGGGAGG + Intronic
1166313847 19:41977847-41977869 CAGTGCAGAGGGAGGTTGGGGGG + Intronic
1166760015 19:45218355-45218377 AAGTGAAGAGGGAGGGTGGGAGG - Intronic
1166874146 19:45886951-45886973 CAGAAAAGTGGGGGGGCGGGGGG - Intergenic
1166877128 19:45904049-45904071 CTGTGTGGAGGGTGGGTGGGAGG + Intergenic
1167074639 19:47240877-47240899 CAGTGATGTGGCTGGGGAGGAGG + Intergenic
1167463136 19:49636781-49636803 CGGAGCAGTGGGTGGGTGTGGGG - Intronic
1167906549 19:52665264-52665286 CAGGGATGTGGGTGGGGTGGTGG + Intronic
1168563539 19:57403727-57403749 CACTGAAGTGTGTGGATGGTGGG + Intronic
1202637445 1_KI270706v1_random:54838-54860 CAGTGAGGGGTGTGGGTGGTAGG - Intergenic
1202703501 1_KI270713v1_random:4742-4764 AAGTGAGGTGGGCGGGGGGGCGG + Intergenic
925017597 2:543661-543683 CAGGGAGGGGGGAGGGTGGGAGG + Intergenic
925247643 2:2398795-2398817 CAAGAAAGGGGGTGGGTGGGTGG - Intergenic
925344833 2:3163818-3163840 CAGGGAGGTGGGAGGATGGGTGG + Intergenic
925385926 2:3461723-3461745 AAGGGAAGGGGGCGGGTGGGAGG - Intronic
925463985 2:4089698-4089720 CAGGGAGGTGCCTGGGTGGGTGG - Intergenic
925940812 2:8816003-8816025 CAAAGGATTGGGTGGGTGGGTGG - Intronic
926145586 2:10395453-10395475 CAGTCAGGGGGGTGGGTTGGTGG + Intronic
926145588 2:10395457-10395479 CAGGGGGGTGGGTTGGTGGGTGG + Intronic
927340285 2:21975913-21975935 CAGTAAAGAAGGAGGGTGGGTGG - Intergenic
927707911 2:25308181-25308203 CAGGTAGGTGGGTGGGTGGATGG + Intronic
927871155 2:26624724-26624746 AAGTTTAGTGGGAGGGTGGGGGG + Intronic
928170388 2:28999490-28999512 CCTGGAAGTGGGTGGGTGAGGGG - Intronic
928422771 2:31151983-31152005 GAGCGAAGTGGGTGGCTGAGAGG - Intronic
928439936 2:31284022-31284044 CTGGGAAGTGGCTGGGTGGGAGG - Intergenic
929307582 2:40381279-40381301 CAAGCATGTGGGTGGGTGGGTGG - Intronic
929448709 2:42021665-42021687 CACTGAACTGGGTGGGGGTGGGG - Intergenic
929569859 2:43015693-43015715 CAGTGCTGTGGGTAGGTGTGGGG - Intergenic
930003671 2:46879502-46879524 TAGGTAGGTGGGTGGGTGGGTGG + Intergenic
930146675 2:48014086-48014108 TAATGAGGTGGGTAGGTGGGTGG + Intergenic
930824981 2:55687803-55687825 TGGTGGAGTGGGTGGGTTGGGGG - Intronic
931245989 2:60493410-60493432 CAGGGAATGGGGTGGGAGGGGGG - Intronic
931281002 2:60791629-60791651 GAGGGTTGTGGGTGGGTGGGTGG + Intronic
932315402 2:70778211-70778233 CAGTGAAGTGTTGGGGTTGGGGG - Intronic
932422045 2:71606920-71606942 CAGAAGAGTGGGTGGATGGGAGG - Intronic
932448024 2:71792465-71792487 CAGTGAAGTGGGTGGGAGCATGG + Intergenic
933676613 2:85063204-85063226 CAGTGAAGATGGTGGGAAGGGGG - Intergenic
933899033 2:86836109-86836131 CAGAAAGGTGGGTGGGTGGATGG + Intronic
934247821 2:90323410-90323432 CAGTGGCGGGGGGGGGTGGGGGG + Intergenic
935597224 2:104888704-104888726 GAAGGAAGTGGGTGGGTGGATGG - Intergenic
936639332 2:114294649-114294671 CAGGGAAGTGGCTTGCTGGGAGG - Intergenic
937067456 2:119028639-119028661 CGATGGAGTGGGTGGCTGGGCGG + Intergenic
937303508 2:120857417-120857439 TAGGTAGGTGGGTGGGTGGGTGG - Intronic
937552244 2:123108342-123108364 CAGTGAACTGGGTGTGGGGAGGG - Intergenic
938287240 2:130128551-130128573 CTGTGGAGGGGGTGGTTGGGGGG - Intronic
938469260 2:131544322-131544344 CTGTGGAGGGGGTGGTTGGGGGG + Intergenic
938972591 2:136446098-136446120 CGGGGTTGTGGGTGGGTGGGAGG - Intergenic
939178660 2:138780406-138780428 CAGGGAAGGGGGAGGGTGGGCGG + Intergenic
939208187 2:139134839-139134861 CTGTGAGGTGGGTGGGTTGGGGG - Intergenic
939979184 2:148758153-148758175 TACTGATGTGGGTGGGTGGGTGG + Intronic
941137800 2:161739100-161739122 GCATCAAGTGGGTGGGTGGGGGG + Intronic
941574392 2:167212891-167212913 CAGAGGGGTGGGGGGGTGGGGGG - Intronic
942405852 2:175653966-175653988 CAGTGGAAAGGGTGGGAGGGGGG + Intergenic
942749988 2:179276566-179276588 CAGTGAACTGGGTGGGGCAGAGG + Intergenic
943736779 2:191365080-191365102 AAGTTAAGTGGGTGGGTGTTTGG + Intronic
944260130 2:197667948-197667970 CAGTGGGCTGGGTGGGTAGGAGG + Intronic
944283261 2:197922647-197922669 GAGGGAGGTGGGGGGGTGGGGGG - Intronic
946260493 2:218486458-218486480 CAGGCAACTGGGTGGGAGGGAGG + Intronic
946288878 2:218728143-218728165 CACTGACTGGGGTGGGTGGGTGG + Intronic
946331236 2:219010274-219010296 CAGTGAAGAGGGTGGGATGGAGG + Intronic
946405845 2:219491729-219491751 CAGGGAAGTGGGGGCGGGGGAGG - Intronic
946475899 2:220006002-220006024 AAGTGAGGAGGGCGGGTGGGTGG + Intergenic
946797727 2:223373402-223373424 CAGAGGAGTGGGTGTGTGGGGGG + Intergenic
947502530 2:230681849-230681871 CAGAGACAAGGGTGGGTGGGTGG + Intergenic
948211128 2:236193916-236193938 CAGTGTTGTGTGTGGGTGGGTGG + Intergenic
948231282 2:236351306-236351328 GGGAGAAGTGGGCGGGTGGGGGG + Intronic
948279552 2:236736357-236736379 CAGGGCAGGGGGTGGCTGGGGGG + Intergenic
948653220 2:239462051-239462073 GAGTGAAGAGGGAGGGTGGCCGG - Intergenic
948683258 2:239652256-239652278 CAGGGATGGGGATGGGTGGGCGG + Intergenic
948695676 2:239732066-239732088 GGGTGGAGTGGGAGGGTGGGAGG - Intergenic
948697658 2:239741225-239741247 CAGTGATGTGGGTGGGCTGTGGG + Intergenic
948718248 2:239880271-239880293 CAGTGCATGGGGTGGGGGGGTGG - Intergenic
948742563 2:240057273-240057295 CAGTGAAGTGACTGGGTCTGGGG - Intergenic
948753842 2:240147407-240147429 GTGTTAAGTGGGTGGGTGTGGGG + Intergenic
948815602 2:240508835-240508857 TAGGTAGGTGGGTGGGTGGGTGG + Intronic
948850737 2:240704151-240704173 CAGTGCAGCGGGTGGGGAGGAGG + Intergenic
948899829 2:240950659-240950681 CAGATAGGTGGGTGGGTGAGTGG - Intronic
1168875998 20:1172687-1172709 CAGTGTGGTGGGTGAGGGGGAGG + Intronic
1169432019 20:5544929-5544951 CAGAGAGGTGGGTGGGTGGCAGG + Exonic
1169874202 20:10278911-10278933 CGGGGAAGTGGGTGGGGCGGGGG + Intronic
1170409899 20:16077751-16077773 AAGTGCAGTGGGGGGTTGGGAGG - Intergenic
1170684705 20:18559064-18559086 CAGGGAAGGTGGTTGGTGGGGGG + Intronic
1171290920 20:23982416-23982438 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1171339942 20:24419904-24419926 AAGTGAAGTGGGGGAGGGGGAGG + Intergenic
1172160014 20:32861259-32861281 CAGTGGAGTGGGTAGGATGGTGG - Intronic
1172771279 20:37384069-37384091 CTGTGGAATGGGTGGGAGGGAGG + Intronic
1172993397 20:39052245-39052267 CAGTGAGGGGTGGGGGTGGGAGG + Intergenic
1173025758 20:39305901-39305923 CTGTGCTGGGGGTGGGTGGGAGG + Intergenic
1173265156 20:41472452-41472474 TGGTGAAGAAGGTGGGTGGGTGG - Intronic
1173435452 20:43028382-43028404 CAGGGAAGTTGGGAGGTGGGAGG - Intronic
1173647068 20:44639966-44639988 CAGAGAGGTGGGAGGGTGTGTGG + Intronic
1173658929 20:44719820-44719842 CAGAGAAGTGGCTGGTTGTGAGG + Intronic
1173833778 20:46111596-46111618 CAGTGCAGGGGGTGGGGGAGAGG + Intergenic
1174036817 20:47673632-47673654 CATTGAAGGGGATGGGAGGGTGG - Intronic
1174115824 20:48225805-48225827 CAGATCTGTGGGTGGGTGGGTGG - Intergenic
1174121301 20:48267848-48267870 CAGTAAAGTGGGTCCTTGGGAGG - Intergenic
1174150552 20:48483309-48483331 CAGTGGGGCTGGTGGGTGGGAGG - Intergenic
1174330183 20:49811929-49811951 CTCTGAAGTGTGTGGGAGGGGGG - Intergenic
1174429241 20:50456024-50456046 CAGAGAAGTGGGTCTGTGTGGGG - Intergenic
1174541586 20:51293723-51293745 AGGTGGGGTGGGTGGGTGGGTGG - Intergenic
1174677921 20:52376157-52376179 GGGTGAAGTGGGTTGGTAGGTGG - Intergenic
1175498065 20:59428884-59428906 CAGTGAAGTGGGAACATGGGAGG + Intergenic
1175772562 20:61632852-61632874 TGGAGAAGTGAGTGGGTGGGAGG - Intronic
1175780256 20:61677650-61677672 TAGGTAGGTGGGTGGGTGGGTGG + Intronic
1175789388 20:61731936-61731958 AAGGGGAGTGGGTGGGTAGGGGG - Intronic
1175796854 20:61776620-61776642 CAGTGAGGTGGGTGCGTGTTAGG + Intronic
1175872233 20:62213973-62213995 CAGTGCTGGGGGTGGGTGGAGGG - Intergenic
1175901228 20:62360591-62360613 TAGGTAGGTGGGTGGGTGGGTGG + Intronic
1175982576 20:62746485-62746507 CAGTGATGTTTGTGGGAGGGAGG + Intronic
1176022338 20:62968167-62968189 CAGGGCAGTGGGTGGGTGGCGGG + Exonic
1176111570 20:63413346-63413368 GAGTGCAGGGGGTGTGTGGGCGG - Intronic
1176115204 20:63429167-63429189 GAGTGAGGTGGGTGGGAGTGGGG - Intronic
1176268837 20:64224874-64224896 CTGTGAAGTGGATGCTTGGGCGG + Intronic
1176273479 20:64248584-64248606 AAGGGAAGTGGGTGGATGTGTGG - Intergenic
1176511689 21:7753388-7753410 ATGTGAAGTGGATGGGTGTGAGG + Intronic
1176966691 21:15219025-15219047 CAGTGCATTGGGGGGGTGGGTGG + Intergenic
1178278229 21:31258148-31258170 GGGTGAAGTGGGTGTGTGTGTGG - Intronic
1178645803 21:34383916-34383938 ATGTGAAGTGGATGGGTGTGAGG + Intronic
1178878804 21:36432571-36432593 AAGTGAAGTGGGTGGGGAGCGGG - Intergenic
1179962409 21:44776105-44776127 CAGTGAAGTGGCCGGGGGTGGGG + Intronic
1179998383 21:44984394-44984416 CAGTGTTGGGGGTGTGTGGGGGG - Intergenic
1180024971 21:45155877-45155899 GGGTGATGAGGGTGGGTGGGTGG - Intronic
1180025171 21:45156667-45156689 TAGAGAAGTGGGTGCGTGGGGGG - Intronic
1180144027 21:45909791-45909813 CTGGGCAGTGGGTGGGGGGGGGG - Intronic
1180182463 21:46124108-46124130 CAGGTGAGTGGGTGGGTGGATGG + Intronic
1180749443 22:18114020-18114042 CAGTGATGGGGGTGGGCAGGAGG + Intronic
1180750358 22:18120029-18120051 CAGGGCAGGGTGTGGGTGGGAGG + Intronic
1180779820 22:18513728-18513750 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1181030086 22:20145459-20145481 CAGAGAAGTTGGTGGGGAGGGGG - Intronic
1181198692 22:21205296-21205318 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1181290291 22:21786911-21786933 CAGCCATGGGGGTGGGTGGGGGG + Intronic
1181478846 22:23184910-23184932 CACTCATGGGGGTGGGTGGGGGG + Intronic
1181648475 22:24246379-24246401 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1181703017 22:24631583-24631605 GACTGCAGCGGGTGGGTGGGTGG + Intergenic
1181870417 22:25893895-25893917 CAGAGAAGTGGGTGCATGGGTGG - Intronic
1182213155 22:28693449-28693471 CAGGGAAGTGGGGGAGGGGGAGG - Intronic
1182249625 22:28989775-28989797 AGGTGAAGAGGGTGGGTGGTGGG - Intronic
1182676358 22:32042656-32042678 CAGGAATGTGGGTGGGTGGGTGG + Intergenic
1182829157 22:33290706-33290728 CAGTCAAGTAGGTGGGTGTGAGG + Intronic
1182966475 22:34526286-34526308 TATTTAAATGGGTGGGTGGGTGG - Intergenic
1183357817 22:37368886-37368908 CAGAAGGGTGGGTGGGTGGGTGG - Exonic
1183491086 22:38115951-38115973 CAGTGCAGCGGGTGGGCTGGTGG + Intronic
1183516944 22:38272440-38272462 CAGTGACCTGGGAGGGTGGTCGG - Intronic
1183596458 22:38815445-38815467 CGGTGGAGTGGGGGTGTGGGGGG + Intergenic
1183677233 22:39306429-39306451 CAGAGAAGTGGGTGAAAGGGCGG - Intergenic
1184156951 22:42674157-42674179 CAGTGGAGTGGGTGCTGGGGAGG - Intergenic
1184246330 22:43237519-43237541 CAGGCAAGTGGGCAGGTGGGTGG - Intronic
1184347613 22:43923432-43923454 CTGTTAAGTCGGGGGGTGGGAGG - Intergenic
1184444496 22:44539470-44539492 TAGTTAGGTGGGTGGGTGGACGG + Intergenic
1184662182 22:45970534-45970556 AAGGGAAGTGGGGGGGTTGGGGG - Intronic
1184788974 22:46687579-46687601 AATGGAGGTGGGTGGGTGGGTGG - Intronic
1184860087 22:47168684-47168706 CAGAACAGTGGGTGGGTGGGTGG - Intronic
1185063871 22:48621077-48621099 TAGTAGATTGGGTGGGTGGGTGG - Intronic
1203228113 22_KI270731v1_random:89541-89563 GACTGCAGCGGGTGGGTGGGTGG + Intergenic
950202926 3:11057552-11057574 CAGGTAGGTGGGTGGGTTGGTGG + Intergenic
950203030 3:11057981-11058003 CAGGTAGGTGAGTGGGTGGGTGG + Intergenic
950203032 3:11057985-11058007 TAGGTGAGTGGGTGGGTGGGTGG + Intergenic
950214233 3:11146907-11146929 CAGTGACCTGTGTGGATGGGTGG + Intronic
950442453 3:13018074-13018096 CACTTCAGTGTGTGGGTGGGTGG + Intronic
950532218 3:13558797-13558819 TAGGTAGGTGGGTGGGTGGGTGG - Intronic
950613064 3:14138475-14138497 CATAGATGTGAGTGGGTGGGTGG + Intronic
950717312 3:14858336-14858358 TCCTGAAGCGGGTGGGTGGGTGG + Intronic
951709762 3:25576121-25576143 CAGGGATGGGGCTGGGTGGGAGG + Intronic
952149897 3:30578122-30578144 CAGTTCAGTGGGTTGGGGGGTGG - Intergenic
952210714 3:31226604-31226626 CAGTGAAGTGGTGGGGGTGGGGG + Intergenic
952588971 3:34928304-34928326 CATAGAAGTGGGAGGGTGGGAGG + Intergenic
953582668 3:44171580-44171602 GAGTGGGGTGGGTGGGAGGGTGG - Intergenic
953845602 3:46423599-46423621 AAGGGGAGTTGGTGGGTGGGTGG + Intergenic
953927989 3:46992079-46992101 CAGTTCAGTGGGAGGGTGTGGGG + Intronic
954222366 3:49162619-49162641 CGGTGGGGTGGGTGGGCGGGAGG - Exonic
954390246 3:50264843-50264865 CTGTGATGTGGCTGGTTGGGGGG + Intergenic
954759311 3:52862362-52862384 TGGTGGAGTGGATGGGTGGGTGG - Intronic
954906505 3:54067706-54067728 CTGTGAAGTGGAGGGGTGGCAGG + Intergenic
955102031 3:55859676-55859698 TGGGGATGTGGGTGGGTGGGAGG - Intronic
955126014 3:56113732-56113754 ATCTGAAGTGGGAGGGTGGGGGG - Intronic
955492449 3:59496839-59496861 TGATGAAGTGGGTGGGTGTGTGG - Intergenic
955780525 3:62479357-62479379 CGAGGAAGTGGGTGGGGGGGAGG - Intronic
956024557 3:64969279-64969301 GAGTGAATTGGGGGGGTGGGCGG - Intergenic
956094981 3:65706744-65706766 CAGCGTAATGGATGGGTGGGTGG + Intronic
956303948 3:67804138-67804160 CAGTGTACTGGGTGGGTGAGTGG + Intergenic
956350765 3:68333475-68333497 GAGTGTAGAGGGTGGGTGGAGGG + Intronic
956370273 3:68551457-68551479 CAGTGAAGTGGGTGTAAGAGAGG - Intergenic
956451025 3:69375032-69375054 TGGGTAAGTGGGTGGGTGGGTGG - Intronic
956451054 3:69375163-69375185 CAGGTAAGTGGGTGGGTGGGTGG - Intronic
956693353 3:71898153-71898175 CATTGAAGTGGGTGGCTTGGAGG - Intergenic
956900586 3:73711804-73711826 TAGTGGAGTGTGTGTGTGGGGGG - Intergenic
957040439 3:75331894-75331916 CATTGAGGAGGGTGGCTGGGAGG - Intergenic
958027804 3:88069454-88069476 CATTCAAGTGGGTTGGGGGGTGG - Intronic
958042941 3:88247583-88247605 CAGTAAAGGGGGGCGGTGGGGGG + Intergenic
958465615 3:94453989-94454011 CAGTTCAGTGAGTGGGAGGGAGG - Intergenic
958786581 3:98603247-98603269 AAGTGAAATGGGGGGGTGGGAGG + Intergenic
959649413 3:108737236-108737258 GAGGGGAGTGGGTGGGTGGGTGG - Intergenic
960677918 3:120214801-120214823 CAGTTAAGTGGGTGAGGGGGTGG + Intronic
961008231 3:123419277-123419299 AAGAGAAGTGGGTGGGCGGACGG - Intronic
961045224 3:123703456-123703478 CATTGAGGAGGGTGGCTGGGAGG - Intronic
961135280 3:124504467-124504489 CAGCATAGTGGGTGGATGGGAGG - Intronic
961650687 3:128415356-128415378 CAGGGAAGAGGGTGGTGGGGTGG + Intergenic
961836207 3:129662174-129662196 CAGAGGAGATGGTGGGTGGGTGG + Intronic
962260206 3:133897295-133897317 CAGAGAAGTGGGTGGGTGTCTGG - Intergenic
962407254 3:135110857-135110879 CAGGGCAGTGGTGGGGTGGGGGG + Intronic
962741818 3:138367548-138367570 CTAGGAAGTGGGTGGCTGGGTGG - Intronic
963475632 3:145800006-145800028 GAGTGTAGTGGGGGTGTGGGAGG - Intergenic
963499842 3:146112483-146112505 CAGTGGAGTTTGTCGGTGGGCGG + Intronic
964256693 3:154782667-154782689 GAGTGGAGTGGGTGGGAGGTGGG - Intergenic
964270987 3:154956659-154956681 CAGTGAAGTGGGGAAGTGGGTGG + Intergenic
964632999 3:158833022-158833044 CAGTGGATAGAGTGGGTGGGAGG + Intergenic
964733134 3:159888712-159888734 AATTGCAGTGGGTGGGTGAGTGG + Intronic
964742415 3:159980694-159980716 AAGACAAATGGGTGGGTGGGTGG + Intergenic
964809913 3:160652441-160652463 ATATGAATTGGGTGGGTGGGGGG - Intergenic
967155315 3:186686269-186686291 TAGTGCAGAGAGTGGGTGGGTGG + Intergenic
967291664 3:187926800-187926822 AAGGGAAGTGTGTGGGTGGAGGG - Intergenic
967411601 3:189171866-189171888 CAGAGAATTGGGTTTGTGGGTGG - Intronic
967455156 3:189676855-189676877 CACTGATGTTGGGGGGTGGGTGG - Intronic
967774127 3:193368746-193368768 CAGTGGGGTGGGGCGGTGGGGGG - Intronic
968076386 3:195817855-195817877 CAGGGAGGTGGGTGGGCTGGGGG + Intergenic
968957481 4:3726706-3726728 CAGGGCAGTGGGGCGGTGGGTGG - Intergenic
969899277 4:10333764-10333786 CAGTGAAGGGGTCGGGGGGGTGG + Intergenic
970191659 4:13523930-13523952 CGGTGGAGTGGGTGGGTGAGGGG - Intergenic
970346979 4:15161917-15161939 CAGTGAATTGTGTGTGTGGCAGG + Intergenic
970464161 4:16306409-16306431 CACTGAAGTGGGTGGGGTTGTGG - Intergenic
970852928 4:20623442-20623464 CAGAGCAGAGGGTGGGTTGGAGG - Intergenic
971476633 4:27078667-27078689 CACTGAAGTGGGTGGTGAGGAGG + Intergenic
971485582 4:27156748-27156770 CAGGGAAGGGGGTGGGGGTGAGG + Intergenic
973117120 4:46475782-46475804 CAGGGTAGGGGGTTGGTGGGTGG - Intergenic
973367692 4:49221203-49221225 CAGTGAGGGGTGTGGGTGGTAGG - Intergenic
973393365 4:49574226-49574248 CAGTGAGGGGTGTGGGTGGTAGG + Intergenic
973982484 4:56317747-56317769 GAGGGTAGGGGGTGGGTGGGGGG - Intronic
974339465 4:60596344-60596366 CTGTGATGTGGTTGGGTGGTAGG - Intergenic
975080030 4:70266048-70266070 AAGGGTAGTGGGTGGATGGGAGG + Intergenic
976223248 4:82775049-82775071 CAGTGAAGTGGCAGGCTGTGGGG - Intronic
976286863 4:83379005-83379027 AAGGGGAGTGGGTGGATGGGTGG - Intergenic
976338443 4:83918016-83918038 AAGAGTAGTGGGTGGGTAGGTGG - Intergenic
976733636 4:88288387-88288409 CAGGGCTTTGGGTGGGTGGGTGG + Intergenic
977635994 4:99299238-99299260 CAGTGATAAGGGTGGGAGGGAGG + Intergenic
977842627 4:101727376-101727398 GACTGAAGAGGGTGGGTGGAAGG - Intronic
978038913 4:104033666-104033688 CAGGGAGGTGGGAGTGTGGGAGG + Intergenic
978230478 4:106391857-106391879 ATGGGAGGTGGGTGGGTGGGAGG - Intergenic
978364299 4:107964625-107964647 CAGGGGGGTGGGGGGGTGGGGGG - Intergenic
979198555 4:117949427-117949449 CAGTGGAGTAGGTGGGTGAAGGG + Intergenic
979223604 4:118259248-118259270 CAGTGAGCTGTGTGTGTGGGAGG - Intergenic
979473824 4:121131628-121131650 GTGTGGAGTGGGTGGGTAGGGGG + Intronic
979610656 4:122685557-122685579 AAAGGCAGTGGGTGGGTGGGTGG + Intergenic
979768926 4:124498387-124498409 TGGTGAAGTGGGTGGGTGGATGG + Intergenic
980022945 4:127730832-127730854 CAGAGAAGAGGGTGGCTGGGAGG + Intronic
980343748 4:131584570-131584592 GAGGGGAGTGGGTGGGTGAGTGG + Intergenic
981142949 4:141291699-141291721 CAGTGAGCCAGGTGGGTGGGCGG + Intergenic
982611305 4:157576873-157576895 GAGTGAACGAGGTGGGTGGGTGG + Intergenic
983254017 4:165378784-165378806 CAGTGACGTGGGTGGGTCATGGG + Intronic
983439588 4:167764358-167764380 CAGGGAAGAGGTTGGGTGGAGGG + Intergenic
983997430 4:174201645-174201667 CAAAAAAGTGGGTGGGGGGGTGG + Intergenic
984713498 4:182905063-182905085 CAGAGAAGTGGGGTGGTGGCTGG - Intronic
985380544 4:189390293-189390315 CAGATGAGTGGGTGAGTGGGTGG + Intergenic
1202764762 4_GL000008v2_random:140692-140714 CAGTGAGGGGTGTGGGTGGTAGG - Intergenic
985577286 5:679300-679322 CAGGGAAAGGGGTGAGTGGGTGG - Intronic
985592201 5:771351-771373 CAGGGAAAGGGGTGAGTGGGTGG - Intergenic
985662870 5:1166063-1166085 CAGATGAGTGGGTGGGTGAGTGG - Intergenic
985821218 5:2161337-2161359 CAGGCGGGTGGGTGGGTGGGTGG - Intergenic
986618412 5:9644126-9644148 CATTGAAGTGTTTGGGTGAGGGG + Intronic
986939576 5:12935096-12935118 GAGGGGAGTGGGTGGATGGGGGG - Intergenic
986969079 5:13311104-13311126 TAGGTAGGTGGGTGGGTGGGTGG + Intergenic
987005120 5:13702923-13702945 ACGTGAGGTTGGTGGGTGGGAGG - Intronic
987147732 5:15008794-15008816 CAGTGATGTGGGAAGGTGGGAGG + Intergenic
988039390 5:25870232-25870254 AAGTGTAGTGGGTAGGTCGGGGG - Intergenic
988068379 5:26252785-26252807 CAGAAAGGTGGGAGGGTGGGAGG - Intergenic
991124339 5:63052594-63052616 TAGTGAATTGTGGGGGTGGGAGG + Intergenic
991419390 5:66426021-66426043 AAGGGTAGTGGGTGGGTGGTAGG + Intergenic
991602317 5:68365934-68365956 AAAAGAAGTGGGTGGGTGAGTGG + Intergenic
991627808 5:68622420-68622442 CATTGAATTGGGGGGGTGGGTGG + Intergenic
991812520 5:70487570-70487592 CAGTGTAGTGGCTGGGCTGGGGG - Intergenic
991815478 5:70508047-70508069 CAGTGTAGTGGCTGGGCTGGGGG - Intergenic
991937700 5:71818125-71818147 CATAGAAGTGTGTGTGTGGGAGG + Intergenic
992413648 5:76532470-76532492 CTGAGGATTGGGTGGGTGGGGGG + Intronic
992978662 5:82142661-82142683 CAGTGTGGAGGGTGCGTGGGAGG + Intronic
993097348 5:83494852-83494874 GAGAGAAGTGTGGGGGTGGGGGG + Intronic
993389581 5:87302226-87302248 TAGTGATGTAGGTGGGTTGGTGG + Intronic
993401788 5:87462355-87462377 CTGTGAAGTGGGTGGGTGTGGGG - Intergenic
993416381 5:87638505-87638527 GGGTGAAGTGGGTGGGGGTGGGG + Intergenic
993447163 5:88027521-88027543 CAGGGCAGTGGTTAGGTGGGTGG - Intergenic
994178756 5:96740917-96740939 CAGAGAAAGGGGTTGGTGGGAGG + Intronic
994366763 5:98926910-98926932 AAATGAAGTGGGGGGGGGGGTGG + Intronic
994475000 5:100256538-100256560 CTGGGGAGGGGGTGGGTGGGTGG - Intergenic
995271807 5:110228184-110228206 TGGTGAAATGGGTAGGTGGGTGG - Intergenic
995525742 5:113049360-113049382 CTGCCAAGTGGGTGGGTGGGGGG + Intronic
995872278 5:116756061-116756083 CAGAGAAGTTGGGGGGTGGGGGG - Intergenic
996385411 5:122905235-122905257 GAGTGAAGTGGGAGATTGGGAGG + Intronic
996488546 5:124065500-124065522 CTGTGAAGTGGGTGGGTTATTGG + Intergenic
997820501 5:137061741-137061763 GAGTGGAGGGGGCGGGTGGGAGG + Intronic
998037076 5:138926465-138926487 CACAGGTGTGGGTGGGTGGGTGG - Intronic
998079160 5:139260397-139260419 AAGAGAAGTGGGTGGGAGTGAGG - Intronic
998133776 5:139664179-139664201 CAGGGAGGAGGGTGGATGGGTGG + Intronic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
999014498 5:148085584-148085606 AGGTGAAGTGAGTGGGTGGCAGG + Intronic
999295778 5:150458785-150458807 GAGGGGAGGGGGTGGGTGGGAGG + Intergenic
1000092761 5:157944501-157944523 CAGTGGAGGGGGTCGGTAGGAGG + Intergenic
1000194325 5:158943043-158943065 GAGGGAAGTGGGAGGGAGGGAGG + Intronic
1000214875 5:159145772-159145794 TAGTGAACTGGGTGGGTGGGAGG + Intergenic
1000280857 5:159780728-159780750 CTGTGCAGTGTGTGGGTAGGAGG - Intergenic
1001155204 5:169266620-169266642 TACTGGACTGGGTGGGTGGGAGG + Intronic
1001329959 5:170754848-170754870 AAGATGAGTGGGTGGGTGGGTGG + Intergenic
1001518455 5:172373669-172373691 CAGTGATGTGGATGGGTGGATGG - Intronic
1001617846 5:173056866-173056888 CAGAGAAGAGAGCGGGTGGGAGG + Intronic
1002073545 5:176694895-176694917 CAGAGCAGTGGGCTGGTGGGTGG + Intergenic
1002182176 5:177436336-177436358 CAGGTGAGTGGGTGGGAGGGAGG - Intronic
1002182178 5:177436340-177436362 CAGGCAGGTGAGTGGGTGGGAGG - Intronic
1002495316 5:179607673-179607695 CAGGGCACTGGGAGGGTGGGTGG - Intronic
1002715434 5:181223960-181223982 CAGTGTAGAGGTTCGGTGGGGGG - Exonic
1003011230 6:2429109-2429131 CAGTGAAGTGGGGGGGAAAGTGG + Intergenic
1003115567 6:3281647-3281669 CTGTGAAGTGGGGGGATGGTAGG + Intronic
1004125199 6:12866391-12866413 CAGGGATGTGGGTGGAAGGGTGG - Intronic
1004157516 6:13183432-13183454 CAGTCACGTGGGAGGGTGGGAGG + Intronic
1004397284 6:15256580-15256602 GTGTGAAGTGGATGGGTGGCAGG - Intronic
1004494920 6:16154545-16154567 CAGTGCTGTGGGTGGGTTGGGGG - Intergenic
1005164622 6:22905505-22905527 CAGTGAGGTGGGTGGCAGGGGGG + Intergenic
1005258825 6:24034814-24034836 CAGGGGAGTGAGTGGATGGGCGG + Intergenic
1005696527 6:28356959-28356981 AAGGGGAGTGGGTGGATGGGGGG + Intronic
1006194086 6:32227234-32227256 CAGAGAAGTGGTTAGGTGGAAGG + Intergenic
1006272316 6:32973703-32973725 TTGTGTAGTGGGTGGGTGGAAGG + Intronic
1006501714 6:34463736-34463758 CAAGCATGTGGGTGGGTGGGGGG - Intergenic
1006680764 6:35795528-35795550 CAGTGAGATGGGTGGGGGTGGGG - Intronic
1007039157 6:38705527-38705549 GGCTGAGGTGGGTGGGTGGGTGG - Intergenic
1007067607 6:39007785-39007807 CAGTGGGGTGGGGTGGTGGGAGG - Intronic
1007220928 6:40278170-40278192 CAGTAGAGTCGGTGGGTGGAGGG + Intergenic
1007231381 6:40349619-40349641 CAGTGGTGTGAGTGGGTGGGTGG + Intergenic
1007739727 6:44003164-44003186 CCGCGAGGTGGGTGGGTGGAGGG - Exonic
1008638158 6:53433010-53433032 CAGTTCACAGGGTGGGTGGGTGG - Intergenic
1009863338 6:69364332-69364354 GAGTGCAGAGGGTGAGTGGGTGG + Intronic
1011843404 6:91530041-91530063 TGGTGAAGTGTGTGGGTGAGTGG - Intergenic
1011878154 6:91988597-91988619 AAGTGTAGTGGGGGGTTGGGAGG + Intergenic
1013180864 6:107715980-107716002 CAGTCATTTGGGTGGGAGGGTGG + Intronic
1013313780 6:108922164-108922186 TACTGCAGTGGGTGGGTGCGAGG - Intronic
1013471745 6:110472382-110472404 CAGTGCAGAGGGTGGATTGGAGG - Intronic
1013638246 6:112048941-112048963 CAGTGGTGTGGGTGGGTGGGTGG - Intergenic
1014856086 6:126402510-126402532 TAGACAAGTGGGTGGGTGGGTGG - Intergenic
1015018173 6:128439233-128439255 TACTGAAGTGGTGGGGTGGGGGG + Intronic
1016362921 6:143287130-143287152 CAGAGAAATGTGTGTGTGGGAGG - Intronic
1016508963 6:144818448-144818470 GAGTGGAGTGAGTGGGTGAGAGG - Intronic
1017300076 6:152846804-152846826 GAGGGAAGTGGGTGGGTGAGTGG + Intergenic
1017821699 6:158053777-158053799 TAGGTAAGTGGGTGAGTGGGTGG - Intronic
1017992230 6:159501065-159501087 GTGTGAAGTGGGGTGGTGGGTGG - Intergenic
1018971192 6:168530649-168530671 CAGAGCAGTGGGTGTGGGGGCGG - Intronic
1019265107 7:110869-110891 CAGAGAAGGGGGTGGGGGTGGGG - Intergenic
1019426559 7:980209-980231 GGGTGAGGTGGGTGGGTAGGTGG - Intergenic
1019497763 7:1348346-1348368 CATTGCAGTGGGTTGGTGGGTGG - Intergenic
1019524799 7:1476113-1476135 CAGTGACAGGGGTGGGTGGACGG + Intronic
1019563714 7:1669871-1669893 AGGTGGAGGGGGTGGGTGGGTGG - Intergenic
1019615127 7:1955973-1955995 AAGTAAGGTGGGTGGGGGGGTGG + Intronic
1019728649 7:2617398-2617420 CAGGGAAGGGTGTGAGTGGGTGG + Intergenic
1020034762 7:4958297-4958319 CAGTGAAGAAGGTGGGCGTGGGG - Intronic
1020803064 7:12756046-12756068 ATGGGGAGTGGGTGGGTGGGAGG + Intergenic
1021019189 7:15575419-15575441 GAGTGAAGTGAAAGGGTGGGAGG - Intergenic
1022103355 7:27182175-27182197 CAGTGTGGTGGGTGGCTAGGAGG + Exonic
1022378718 7:29840139-29840161 TACTGCAGTGGGTGGGTGGTGGG - Intronic
1022585330 7:31603396-31603418 CTGTGGAGTGGGTGGGGAGGGGG - Intronic
1022679154 7:32527817-32527839 GAGGTAGGTGGGTGGGTGGGTGG - Intronic
1022795351 7:33727433-33727455 GAGTGAAGGAGGGGGGTGGGGGG + Intronic
1023912532 7:44566131-44566153 CAGTTGGGTGGGTGGGTGGGTGG - Intronic
1024103963 7:46062348-46062370 CAGTCAAGTTGTTGGCTGGGTGG + Intergenic
1024395513 7:48862243-48862265 GAGTGAAGTGGGTGGGTTCATGG + Intergenic
1024399718 7:48910033-48910055 GAGTGAAGTGGGTGGGTTCATGG - Intergenic
1025055576 7:55762057-55762079 CAGGGCATTGGGAGGGTGGGAGG - Intergenic
1025910386 7:65824094-65824116 CAGGGCATTGGGAGGGTGGGAGG + Intergenic
1025973040 7:66345965-66345987 AAGGGTAGTGGGTAGGTGGGTGG - Intronic
1026103787 7:67404609-67404631 CTGGTGAGTGGGTGGGTGGGTGG + Intergenic
1026809525 7:73451184-73451206 CAGTGGAGTGGGTGGATGACTGG + Intronic
1026904319 7:74054135-74054157 GAGTTAGGTGGTTGGGTGGGTGG + Intronic
1026981378 7:74528784-74528806 CAGCCGGGTGGGTGGGTGGGTGG + Intronic
1027230342 7:76268381-76268403 CACTGGGGTGGGTGGGGGGGTGG + Intronic
1028007549 7:85593893-85593915 CAGTGAAGTGGGGGGGCGGGGGG + Intergenic
1028269994 7:88776782-88776804 AAGTGAACAGGGTGGGGGGGGGG - Intronic
1029118467 7:98250847-98250869 CAGTGAAAGGGAGGGGTGGGGGG + Intronic
1029237258 7:99131454-99131476 CAAGGAAATGGGTAGGTGGGTGG + Intronic
1029250363 7:99232239-99232261 CTGTAAAGTGGGTGGCTGGGTGG - Intergenic
1029972200 7:104800680-104800702 CAAAGAGGTGGTTGGGTGGGTGG - Intronic
1030457016 7:109788191-109788213 TAGTGCGGTGTGTGGGTGGGTGG + Intergenic
1030599646 7:111579174-111579196 AAGTGTAGTGGGAGGGTTGGGGG + Intergenic
1030658740 7:112196482-112196504 CAGGAAGGTGGGTAGGTGGGTGG - Intronic
1031664944 7:124472413-124472435 CAGGGCAGAGGGTGGGTGGTAGG + Intergenic
1031840953 7:126738687-126738709 CAGTGTGGGGGGTGAGTGGGGGG + Intronic
1032247846 7:130228416-130228438 CAAAGAGGTGGGTGGGAGGGTGG + Intergenic
1032454656 7:132064130-132064152 CACAGAGGTGGGCGGGTGGGAGG + Intergenic
1032475811 7:132210885-132210907 CAGTGATGTGGGTGGGACTGGGG + Intronic
1032525951 7:132578119-132578141 CAGTGAAGATGGGGAGTGGGTGG + Intronic
1032680463 7:134177291-134177313 CAGTGAAGAGGTTGGCTGTGGGG + Intronic
1033653998 7:143361672-143361694 GAGTGGAGTGGGTGCCTGGGTGG + Intronic
1034210781 7:149360203-149360225 TGGGGCAGTGGGTGGGTGGGTGG - Intergenic
1034245073 7:149637823-149637845 CAGAGAAATGGGTATGTGGGAGG - Intergenic
1034723297 7:153314804-153314826 GAGGGAGGTGGGTGGGGGGGGGG - Intergenic
1035055140 7:156030198-156030220 CAGGGCAGGGGTTGGGTGGGTGG + Intergenic
1035109242 7:156466712-156466734 CAGTGAAGTGAGAGGGTGCGGGG + Intergenic
1035309304 7:157955017-157955039 GAGTGAAGCGGGTGGGGTGGAGG + Intronic
1035330180 7:158091717-158091739 CAGAGAGATGGTTGGGTGGGTGG + Intronic
1035741143 8:1929665-1929687 GAGAGAAGTGGGAGGGTGGGAGG - Intronic
1035840760 8:2810061-2810083 CAGAGACGTGGCTGGGTGTGGGG - Intergenic
1036495519 8:9266845-9266867 CAGTTAAGTTGGTTGGAGGGTGG - Intergenic
1036617557 8:10400272-10400294 CAGTGGAGAGGGTGGAGGGGAGG + Intronic
1036618211 8:10404775-10404797 CAGTGAGGTGGGTGGCCTGGGGG - Intronic
1036742795 8:11380170-11380192 CAATCAAGTGAGTGGGTGGTAGG + Intergenic
1037092903 8:14945145-14945167 CAATGTTGTGTGTGGGTGGGTGG + Intronic
1037663328 8:20945131-20945153 CACTGAAGAGGGTGGTTGGTGGG + Intergenic
1037820802 8:22133701-22133723 TAGGGATGTAGGTGGGTGGGCGG - Intergenic
1037905669 8:22714731-22714753 CAGGCAGGTGGGAGGGTGGGTGG - Intronic
1038053732 8:23837976-23837998 AAGGGAGGTGGCTGGGTGGGAGG + Intergenic
1038415031 8:27388947-27388969 TGGTGAAGAGGGTGGGTGAGGGG - Intronic
1038871951 8:31504449-31504471 CAGTGGACTGGGGGGGGGGGGGG - Intergenic
1039228740 8:35419611-35419633 CAGCGCAGTGGATGGGAGGGAGG + Intronic
1039573444 8:38604909-38604931 TCTTGAAGTGGGTGGGTGGGGGG - Intergenic
1039988991 8:42472046-42472068 CAGGGAAGCGGGTCAGTGGGCGG + Intronic
1040067886 8:43163111-43163133 CAGTGAGGTGGGAGGGAGGTTGG + Intronic
1040334438 8:46408890-46408912 GAGTGAAGTGGGCGGGTGGCAGG + Intergenic
1040584577 8:48727120-48727142 GGGTGATGTGGGTGTGTGGGTGG - Intronic
1040584594 8:48727177-48727199 GGGTGAGGTGGATGGGTGGGTGG - Intronic
1040641547 8:49340224-49340246 CAGAGGAGTGAGTGGATGGGTGG - Intergenic
1040747774 8:50666466-50666488 CACTGAAGTATGAGGGTGGGAGG + Intronic
1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG + Intergenic
1041444028 8:57930696-57930718 CAGTTGAGTGGGTGAGTGGTAGG + Intergenic
1041562165 8:59230653-59230675 AATTGAGGTGGGAGGGTGGGAGG + Intergenic
1041674670 8:60526319-60526341 AAGGGATGTGGGTAGGTGGGTGG - Intronic
1041718138 8:60950613-60950635 CAGGGAAGTGGGAGGGTGTGGGG + Intergenic
1041748118 8:61231538-61231560 CAGGGAGGTGGGTGGGAGGAAGG - Intronic
1042391434 8:68240205-68240227 CAGAAAGGTGGGAGGGTGGGAGG - Intergenic
1042585021 8:70327009-70327031 CAGTGAAGTGAGTTAGTGGCTGG - Intronic
1042953019 8:74220547-74220569 ATGTTAAGGGGGTGGGTGGGAGG - Intergenic
1043079482 8:75747973-75747995 CAGAAAGGTGGGAGGGTGGGAGG + Intergenic
1043564739 8:81535349-81535371 CAGTGAAGAAGGTGGGAGTGTGG + Intergenic
1043691614 8:83160463-83160485 CAGGGAAAAGGGTGGGAGGGGGG - Intergenic
1043709915 8:83403219-83403241 CCATGGAGTGGGTGGGTGGGAGG - Intergenic
1043760664 8:84063610-84063632 CAGTGGACTGGGTGGGTGCCGGG - Intergenic
1044715134 8:95093116-95093138 GAGTGTAAGGGGTGGGTGGGAGG + Intronic
1045330868 8:101154786-101154808 CAGAGAAGTGGGTTTGTGAGTGG - Intergenic
1045365461 8:101471610-101471632 CAGTGAGGTGGGGGGGTTGTGGG + Intergenic
1045370243 8:101515626-101515648 CAGTGCAGAGGTTGGATGGGGGG + Intronic
1045799261 8:106082803-106082825 CATTAAAGTGGGTGGGAGGCAGG + Intergenic
1046317147 8:112519027-112519049 CAGTGGAGGGGCTTGGTGGGAGG - Intronic
1047180718 8:122585171-122585193 CTGTGGGGTGGGGGGGTGGGGGG - Intergenic
1047285790 8:123486220-123486242 AAGTTAAGTGGGTGGATTGGAGG + Intergenic
1047475720 8:125226954-125226976 AAGTGAACTGGGCTGGTGGGTGG - Intronic
1048063368 8:130943470-130943492 CAGGGAAGAGGGTGGGGGTGGGG + Intronic
1048107861 8:131430967-131430989 CAGTGAGGTTGGAGGGTGGGAGG - Intergenic
1048543099 8:135360945-135360967 CAGGTAGGTGGGTGGGTGGATGG - Intergenic
1048649560 8:136459943-136459965 CAGTGAAGTGTGGGGTGGGGTGG + Intergenic
1048880882 8:138871479-138871501 CAGTGAAGTGGGTCTCTTGGAGG - Intronic
1049155327 8:141062701-141062723 CAGACAAGTGGGTGGGTGGCTGG + Intergenic
1049161096 8:141098452-141098474 CTGTAAAGTGGGTGGGGTGGGGG - Intergenic
1049179137 8:141212148-141212170 CATTCCAGTGGGCGGGTGGGCGG - Intronic
1049359849 8:142207263-142207285 CAGGTAGGTGGGTGGGTGAGTGG + Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049415249 8:142492068-142492090 CAGAGGAGAGGGTGGATGGGTGG - Intronic
1049582355 8:143418421-143418443 AAGATGAGTGGGTGGGTGGGGGG - Intergenic
1049663453 8:143831031-143831053 CAATGGAGGGGGTGGATGGGAGG + Intergenic
1049801930 8:144521947-144521969 CAGTGGGGTGGCTGGGTGGCAGG - Exonic
1049846201 8:144803035-144803057 CTGTGATGTGGGTGGGTGTGAGG - Intronic
1050151334 9:2621969-2621991 CGGGGAGGTGGCTGGGTGGGTGG + Exonic
1050552139 9:6758004-6758026 CCGTCGAGGGGGTGGGTGGGAGG - Intronic
1051608861 9:18942426-18942448 CAGTGAAGGGGTTGGGTGGAAGG - Intronic
1052414422 9:28158614-28158636 CAAGGATGTGGGTGGGAGGGAGG + Intronic
1052569507 9:30201393-30201415 GAGGGGAGTGGGTGGATGGGTGG - Intergenic
1052940306 9:34127094-34127116 CAGGGGGGTGGGGGGGTGGGGGG + Intronic
1053123416 9:35561925-35561947 GAGAGAGGTGGGTGGGAGGGTGG - Intronic
1054365542 9:64335467-64335489 CTCTGAAGTGGGTGAGTTGGAGG + Intergenic
1054720657 9:68600365-68600387 CAGTGATGATGGTGGGTGTGGGG - Intergenic
1055155826 9:73061742-73061764 CAGGGTAGGGAGTGGGTGGGGGG - Intronic
1055336928 9:75241686-75241708 CTATGAAGTGGGGGTGTGGGAGG - Intergenic
1055641264 9:78320531-78320553 CAGATGAGTGGGTGGGCGGGTGG - Intronic
1056474934 9:86945142-86945164 CAGTGACGTGGGGGTGAGGGTGG - Exonic
1056761529 9:89418988-89419010 CAGTGAGGGGCCTGGGTGGGAGG - Intronic
1057178257 9:93014956-93014978 AAGGGAACTGGGGGGGTGGGCGG - Intronic
1057179479 9:93022087-93022109 CAGTGAGGTGGGTGGCTGGTGGG - Intronic
1057246025 9:93454404-93454426 CAGTGATGTGGGGGGTTGGCGGG + Intronic
1057305208 9:93908348-93908370 CAGGGGGGTAGGTGGGTGGGTGG + Intergenic
1057382908 9:94584931-94584953 CAGCAGAGTGGGTGGGTGTGGGG - Intronic
1057796510 9:98161694-98161716 CAGTGAAGTGGACGGGATGGTGG + Intronic
1057834379 9:98432448-98432470 CACTGAGGTGGGTGGGAAGGTGG + Intronic
1057901791 9:98954906-98954928 GAGTGGAGAGGGAGGGTGGGAGG - Intronic
1058587465 9:106525609-106525631 CTCAGAAGGGGGTGGGTGGGAGG + Intergenic
1058793366 9:108472981-108473003 AAGAGATGTGGGTGGGTGAGTGG + Intergenic
1058971365 9:110086158-110086180 CTGAGAAGTGGGAGGGTGTGGGG + Intronic
1059283071 9:113151098-113151120 CGGTGAAGAGGGTGGGCGGTTGG + Intronic
1060401802 9:123353928-123353950 CAGTGCTGCTGGTGGGTGGGGGG + Intergenic
1060485563 9:124044347-124044369 AAGAGAAGTGGGTTGATGGGAGG + Intergenic
1060705463 9:125794760-125794782 AATTGAGGTGGGTGGGTGGGAGG - Intronic
1061045723 9:128163832-128163854 CAGGCAAGTGGGTGGGTTGCAGG - Exonic
1061478252 9:130883609-130883631 GAGTGATGTGGGTGGGTGGGGGG - Intronic
1061590321 9:131593776-131593798 CAGTGAACTGGGTGGGTGTGGGG - Intronic
1061846932 9:133393253-133393275 TAGGTAAGTGGATGGGTGGGCGG + Intronic
1061887867 9:133601861-133601883 CAGCGAGGGGGGTAGGTGGGAGG + Intergenic
1061905694 9:133695726-133695748 CTGTTGGGTGGGTGGGTGGGTGG + Intronic
1061932092 9:133838500-133838522 TGGGTAAGTGGGTGGGTGGGTGG + Intronic
1061938281 9:133870790-133870812 TGGATAAGTGGGTGGGTGGGTGG + Intronic
1061938399 9:133871265-133871287 TAGATAAGTGAGTGGGTGGGTGG + Intronic
1061973040 9:134055007-134055029 CATAGAAGAGGGTGGGTGTGAGG - Intronic
1062020680 9:134318056-134318078 CTGTGAGCTGGCTGGGTGGGGGG - Intronic
1062020690 9:134318091-134318113 CTGTGAGCTGGCTGGGTGGGGGG - Intronic
1062105272 9:134751656-134751678 CCGTGGGGCGGGTGGGTGGGTGG + Intronic
1062112357 9:134789009-134789031 CAGGTAGGTGGGTGGTTGGGTGG + Intronic
1062284850 9:135768331-135768353 CTGTGATGTGGGTTGGGGGGGGG + Intronic
1062514950 9:136928389-136928411 GTGGGAAGTGGGTTGGTGGGTGG + Intronic
1203448446 Un_GL000219v1:84454-84476 AAGGGTATTGGGTGGGTGGGGGG + Intergenic
1203545512 Un_KI270743v1:125580-125602 CAGTGAGGGGTGTGGGTGGTAGG - Intergenic
1185580869 X:1210854-1210876 AAGACAAGTGGATGGGTGGGTGG + Intronic
1185616306 X:1424176-1424198 CAGATGGGTGGGTGGGTGGGTGG - Intronic
1185625022 X:1475100-1475122 TGGATAAGTGGGTGGGTGGGTGG + Intronic
1185695829 X:2193735-2193757 TAGATAGGTGGGTGGGTGGGTGG - Intergenic
1185750474 X:2607049-2607071 GAGAGAGATGGGTGGGTGGGTGG - Intergenic
1185750497 X:2607131-2607153 TAGATAAGTGGGTGGATGGGTGG - Intergenic
1185762739 X:2700965-2700987 TAGTTAAGTGGATGAGTGGGTGG - Intronic
1185762804 X:2701251-2701273 CAGGTAAGTGGATGGATGGGTGG - Intronic
1186410227 X:9340381-9340403 CAGGGAAGTGGGCGGGGTGGGGG - Intergenic
1186481874 X:9902216-9902238 AAAGTAAGTGGGTGGGTGGGAGG + Intronic
1186507439 X:10104199-10104221 GAGTGGGGTGGGTGGGTGGGTGG + Intronic
1186601622 X:11043926-11043948 AAGGGTAGTGGGTGGGTGGGTGG - Intergenic
1186683630 X:11901246-11901268 CAGTGAAGGGGAAGGTTGGGAGG - Intergenic
1186752742 X:12638601-12638623 AGGTGTGGTGGGTGGGTGGGTGG - Intronic
1187149636 X:16669767-16669789 CTGTGCAGTGGATGGCTGGGTGG - Intronic
1187524758 X:20044329-20044351 TAGAGGAGTGAGTGGGTGGGTGG + Intronic
1187685006 X:21807330-21807352 AAGAGAAGTGGGAGGGTGAGAGG - Intergenic
1188500258 X:30818086-30818108 CAATGTTGTGGGTGGGTTGGGGG + Intergenic
1189231601 X:39456184-39456206 CGGGGCAGCGGGTGGGTGGGGGG + Intergenic
1189261033 X:39678997-39679019 CAGTGTATGGGGCGGGTGGGGGG - Intergenic
1189344204 X:40228164-40228186 CAGGGAGGTGGGGTGGTGGGGGG + Intergenic
1189745413 X:44163315-44163337 TTAAGAAGTGGGTGGGTGGGTGG - Intronic
1190063854 X:47227098-47227120 CGGTGAGGCTGGTGGGTGGGTGG + Exonic
1192237987 X:69308019-69308041 GGCTGAAGTGGGCGGGTGGGGGG + Intergenic
1192452647 X:71253525-71253547 CAGTCGAGTAGGGGGGTGGGCGG - Intronic
1192817259 X:74607184-74607206 AAGTGGGGTGGGTGGGAGGGAGG + Intronic
1192842587 X:74872429-74872451 AAGGGTAGTGTGTGGGTGGGGGG + Intronic
1193698192 X:84735085-84735107 CAATGACCTGGGTGGGTCGGAGG - Intergenic
1194471827 X:94306181-94306203 AAGGGTAGTGTGTGGGTGGGTGG + Intergenic
1194506824 X:94743749-94743771 CAGTGAACTGGGTGGGGGGTGGG - Intergenic
1194583906 X:95709939-95709961 TAGTATAGTGGGTGGGGGGGGGG + Intergenic
1194707143 X:97189446-97189468 AAGGGAAGAGGGAGGGTGGGAGG - Intronic
1195123024 X:101775604-101775626 CAGTGGACTGTGGGGGTGGGGGG - Intergenic
1195757160 X:108210870-108210892 CAGTGATGGGGGTGGGTGGCTGG - Intronic
1196059243 X:111389774-111389796 CAGTTATGTGGGTGGATGGTGGG - Intronic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1196563005 X:117173379-117173401 CAGCGATGGGTGTGGGTGGGGGG - Intergenic
1196703695 X:118698389-118698411 CAGAGAAGTGGGTAGGAGGTGGG - Intergenic
1196753670 X:119139362-119139384 CAGGAAAGTGGGAAGGTGGGAGG + Intronic
1196859317 X:120012683-120012705 CAGTACAGTGGGGGTGTGGGGGG - Intergenic
1196896453 X:120341486-120341508 CCGTGAAGTGGGTGGGTCGGGGG + Intergenic
1197018371 X:121655285-121655307 CAGTGAGGGTGGTGGGTGGTGGG + Intergenic
1197253579 X:124239500-124239522 CAGTGAAGTGGGAGGTAGAGAGG - Intronic
1197689084 X:129477783-129477805 CAGGGAGGTGGGTGGGTGGGTGG - Intronic
1198567157 X:137916387-137916409 CAGGGCAGTGGGGGGATGGGGGG + Intergenic
1198702105 X:139408014-139408036 AAGGGTAGTGGGTGGGTTGGGGG - Intergenic
1198774485 X:140165048-140165070 CAGGGAGGTGGGGGAGTGGGTGG + Intergenic
1199397609 X:147357832-147357854 CAGAGAAGTAGGAGGGTAGGAGG + Intergenic
1199496552 X:148458774-148458796 CATTGTAGGGGGTGGGCGGGGGG - Intergenic
1199601507 X:149543962-149543984 CAGTGGAGTGGGTGGTGGGGGGG + Intronic
1199648870 X:149935522-149935544 CAGTGGAGTGGGTGGTGGGGGGG - Intronic
1199707736 X:150445310-150445332 CAATGAGGGTGGTGGGTGGGAGG + Intronic
1199754707 X:150853391-150853413 CAGTGAAGTGGGTGGGTGGGGGG - Intronic
1199987775 X:152964749-152964771 CAGTGAGGTGTGTGTGTTGGGGG + Intronic
1200019489 X:153189844-153189866 TAGGGAGGTGGGTGGGTGTGGGG - Intergenic
1200043797 X:153388833-153388855 CGGTGGACAGGGTGGGTGGGTGG + Intergenic
1200214730 X:154362685-154362707 CAGTGAAGTAGGTGGGCTCGTGG + Exonic
1200279252 X:154762847-154762869 CAGGGCAGTGCGCGGGTGGGTGG + Exonic
1200684369 Y:6246095-6246117 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1200687012 Y:6266419-6266441 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1200992559 Y:9357669-9357691 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1200997876 Y:9398293-9398315 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1201003047 Y:9487139-9487161 CAGGGAAGGCGGGGGGTGGGGGG + Intronic
1201005706 Y:9507422-9507444 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1201008366 Y:9527752-9527774 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1201048265 Y:9908291-9908313 CAGGGAAGGCGGGGGGTGGGGGG - Intergenic
1201186848 Y:11413189-11413211 CAGGGAAGTGGGGGAGGGGGAGG + Intergenic
1201243997 Y:11985835-11985857 CAGTGAAGTGGGGATGAGGGAGG + Intergenic
1202366900 Y:24171784-24171806 CAGGGAGGTGGGTGGATGGAAGG + Intergenic
1202503882 Y:25498339-25498361 CAGGGAGGTGGGTGGATGGAAGG - Intergenic