ID: 1199758762

View in Genome Browser
Species Human (GRCh38)
Location X:150889333-150889355
Sequence GAAACCCATGGGCTAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199758762 Original CRISPR GAAACCCATGGGCTAACCCC AGG (reversed) Intronic
902989713 1:20178236-20178258 GAAAGCCATTGGCTGATCCCTGG - Intergenic
906143290 1:43546084-43546106 GTGACCCGTGGGCTGACCCCAGG - Intronic
910029164 1:82695315-82695337 GAAACCCACAGGGTAACCACAGG - Intergenic
916476812 1:165177466-165177488 GATACCCATGCCCTAACACCTGG + Intergenic
919928956 1:202208839-202208861 GAAATACCTGGGCTAACCCCTGG + Intronic
920343624 1:205291895-205291917 GGAACCCCTGGGGGAACCCCTGG - Intergenic
1070550419 10:77486744-77486766 GAAACCCTTGGGCTTTGCCCGGG - Intronic
1078078589 11:8185063-8185085 GGAACCCTTTGGCTAACCCAAGG + Intergenic
1080048666 11:27836263-27836285 TATATCCATGTGCTAACCCCTGG - Intergenic
1080418541 11:32091223-32091245 GCAGCCCCAGGGCTAACCCCAGG - Exonic
1081445656 11:43129407-43129429 GAACCCCATTGGGTAAACCCTGG - Intergenic
1084683537 11:70680671-70680693 GACATCCATGTCCTAACCCCTGG - Intronic
1087019826 11:93590725-93590747 GAAACACATGGGCTCAACCTAGG - Intergenic
1094439945 12:30463860-30463882 GAAACCCATGGTGTAACTCTCGG - Intergenic
1096113741 12:49043202-49043224 GAAACCCATGGGTCAAGGCCAGG + Intronic
1099083206 12:78212272-78212294 GAAACCCAAGGGCTAGGCCATGG + Exonic
1102351148 12:112193214-112193236 GAAAGCCACGGGCTAAACACAGG + Intronic
1107942994 13:45391300-45391322 GCAGCCCCAGGGCTAACCCCAGG + Intergenic
1111948981 13:94694808-94694830 GAGGCCCATGGGCTAAGCCTTGG + Intergenic
1115416895 14:33145830-33145852 GAAACCCTTGGGTTATACCCTGG - Intronic
1126262869 15:46714653-46714675 GAAGCCCATGTTCTAATCCCCGG - Intergenic
1126856949 15:52847891-52847913 GCAGCCCATTGGCTAATCCCTGG - Intergenic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1137048700 16:35690593-35690615 GAAACCCATGGGCGACCCACAGG - Intergenic
1146565656 17:33910797-33910819 GAAACACATGGGGTTACCTCAGG + Intronic
1147189618 17:38730899-38730921 GAGAGCCACGGGCTAACTCCAGG - Intronic
1157201979 18:45667487-45667509 TAAACCCATGGGCTGAGCTCTGG - Intronic
1158103938 18:53862910-53862932 GAAGTCCATGGACTAAGCCCTGG + Intergenic
1160277568 18:77451756-77451778 GAAGCCCCTGGGCTCTCCCCTGG - Intergenic
1161900062 19:7111790-7111812 CAATCCCATGGTCTAACCCATGG + Intergenic
925977424 2:9150851-9150873 GAACCCCAGGGGCAAACTCCAGG + Intergenic
927514060 2:23661691-23661713 CAAACCCATGAGCAACCCCCAGG + Intronic
933459143 2:82557464-82557486 GAAAGCCTTGGGCTCACACCTGG + Intergenic
936234059 2:110728507-110728529 TAAGCCCATGGGCTGAGCCCTGG + Intergenic
940495174 2:154418302-154418324 GATACCCATGTTCTAACCCCTGG + Intronic
944209247 2:197189226-197189248 GAAACCCATGGACAAATTCCTGG - Intronic
947767782 2:232648581-232648603 GACACCCATAGGGTAACCCCAGG + Intronic
949079606 2:242086227-242086249 GAAACCCATGGAGTAACAGCAGG - Intergenic
1170029233 20:11927513-11927535 GAAAGCCATGGGCTTACACTTGG + Intergenic
1174970275 20:55267351-55267373 GCAACCCCTGGGCTTAGCCCAGG + Intergenic
1176377808 21:6095460-6095482 GAAAGCCTTGTGCTAACCCAGGG - Intergenic
1179124975 21:38582329-38582351 TAAACCCATGTGCTAACTTCCGG + Intronic
1179745666 21:43442788-43442810 GAAAGCCTTGTGCTAACCCAGGG + Intergenic
1182270929 22:29152801-29152823 GGAACCCATGGGGCACCCCCAGG - Intronic
953794755 3:45976056-45976078 GACACCCCTGGTCTCACCCCTGG - Intronic
954791408 3:53135997-53136019 GCAACCCATGGGCAGACCCTGGG - Intergenic
955521456 3:59779378-59779400 GCAACCCATGGACAAAGCCCAGG - Intronic
957849590 3:85790401-85790423 GGAACTTATGGGATAACCCCTGG - Intronic
963328195 3:143885064-143885086 CAAACCCATGAGCTCAGCCCAGG + Intergenic
966347280 3:178993383-178993405 ATACCCTATGGGCTAACCCCTGG - Intergenic
966642060 3:182202827-182202849 AAAACCCATGGGCTAAACCCAGG - Intergenic
968705316 4:2074892-2074914 GAACCCCTTGGGCTGACCGCTGG + Intronic
969339099 4:6529270-6529292 GAAATCCCTGGGTTAATCCCTGG - Intronic
971602952 4:28619198-28619220 GAAATTCATGTGCTTACCCCTGG - Intergenic
979208063 4:118065119-118065141 GAAATCCATGTCCTAATCCCTGG - Intronic
988211473 5:28210125-28210147 GAAACTCAGGAGCTCACCCCGGG - Intergenic
993192036 5:84695640-84695662 GAAACTCAAGGTCCAACCCCTGG - Intergenic
997845156 5:137279262-137279284 GAAACCCATGGTCTAGCCAGAGG + Intronic
999673438 5:153976823-153976845 GAACCCCAAAGGCTGACCCCAGG - Intergenic
1002021122 5:176365249-176365271 AAAAGCCGTGAGCTAACCCCTGG + Intergenic
1003484649 6:6565033-6565055 GAAGCCCCTGGGCTAAAGCCAGG + Intergenic
1006852591 6:37109772-37109794 GAAGCCCATGCTCTCACCCCAGG + Intergenic
1007787691 6:44290692-44290714 GACACCCATGGGCCACACCCAGG + Intronic
1018812197 6:167306379-167306401 GAACCCCATGGCCTCACCACTGG - Intronic
1023460793 7:40394290-40394312 AAAACCCATTTGCTAACCACAGG - Intronic
1026982360 7:74534270-74534292 GGAAAGCATGGGCCAACCCCTGG - Intronic
1029257190 7:99277604-99277626 GAAAGCCATGGCCCAAACCCAGG + Intergenic
1032832003 7:135637312-135637334 GAAAGCCATCGGCTAACCTCTGG + Intronic
1036756838 8:11476742-11476764 GAAACCCAGGTGCAAACACCTGG - Intergenic
1040296639 8:46152311-46152333 GAAGCCCCTGGGGTGACCCCCGG - Intergenic
1041474156 8:58244743-58244765 GACATCCATGGCCTAATCCCTGG - Intergenic
1045486683 8:102637011-102637033 GAAGCCCATGGGTTGAACCCAGG + Intergenic
1047222115 8:122927025-122927047 GATACCCAGGTCCTAACCCCTGG - Intronic
1049010918 8:139886859-139886881 GAATCGCATTGGCCAACCCCAGG + Intronic
1055373991 9:75628939-75628961 GAATCACATGGGCAAAACCCTGG + Intergenic
1060564485 9:124578165-124578187 GAGGTCCATGGACTAACCCCAGG - Intronic
1186164677 X:6813968-6813990 GAAACGCATTGGCTCACCCTTGG + Intergenic
1186676010 X:11818224-11818246 GATACCCATGTCCTAATCCCTGG + Intergenic
1195910018 X:109879897-109879919 GAAAGCCATGGGCAACTCCCAGG + Intergenic
1199484991 X:148337879-148337901 GAAACTCATGTTCGAACCCCTGG - Intergenic
1199758762 X:150889333-150889355 GAAACCCATGGGCTAACCCCAGG - Intronic