ID: 1199760116

View in Genome Browser
Species Human (GRCh38)
Location X:150898700-150898722
Sequence CCGCGCGCGCGCGCGGGCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 174}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199760116_1199760130 20 Left 1199760116 X:150898700-150898722 CCAAAGCCCGCGCGCGCGCGCGG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1199760130 X:150898743-150898765 GGTCGGGCGCGCTAGAGAGCCGG 0: 1
1: 0
2: 0
3: 0
4: 41
1199760116_1199760125 3 Left 1199760116 X:150898700-150898722 CCAAAGCCCGCGCGCGCGCGCGG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1199760125 X:150898726-150898748 GGCCCCGGGAAGATGGAGGTCGG 0: 1
1: 0
2: 0
3: 25
4: 359
1199760116_1199760132 30 Left 1199760116 X:150898700-150898722 CCAAAGCCCGCGCGCGCGCGCGG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1199760132 X:150898753-150898775 GCTAGAGAGCCGGCGCCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1199760116_1199760123 -4 Left 1199760116 X:150898700-150898722 CCAAAGCCCGCGCGCGCGCGCGG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1199760123 X:150898719-150898741 GCGGCGCGGCCCCGGGAAGATGG 0: 1
1: 0
2: 2
3: 26
4: 186
1199760116_1199760131 29 Left 1199760116 X:150898700-150898722 CCAAAGCCCGCGCGCGCGCGCGG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1199760131 X:150898752-150898774 CGCTAGAGAGCCGGCGCCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 55
1199760116_1199760124 -1 Left 1199760116 X:150898700-150898722 CCAAAGCCCGCGCGCGCGCGCGG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1199760124 X:150898722-150898744 GCGCGGCCCCGGGAAGATGGAGG 0: 1
1: 0
2: 3
3: 17
4: 176
1199760116_1199760126 4 Left 1199760116 X:150898700-150898722 CCAAAGCCCGCGCGCGCGCGCGG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1199760126 X:150898727-150898749 GCCCCGGGAAGATGGAGGTCGGG 0: 1
1: 0
2: 0
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199760116 Original CRISPR CCGCGCGCGCGCGCGGGCTT TGG (reversed) Exonic
901506515 1:9689228-9689250 CGGCGCGCGCACGCTGGCTCTGG - Intronic
904563391 1:31413318-31413340 CGGCGCGCGCGGGCGGGCGCCGG - Intronic
904724834 1:32539530-32539552 CCGGTCGCGCGCGCGGGCCGAGG - Exonic
908703855 1:66930135-66930157 CCGCGCGCGCGCCCCTGCTCCGG + Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
910760935 1:90730445-90730467 CCGCGTGCGTGCGCGCGCCTGGG - Intergenic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
915601099 1:156923874-156923896 CCGCCCGCGCGGGAGAGCTTGGG + Intronic
919638709 1:200029247-200029269 GCGCCCGCGCGGGCGGTCTTGGG + Intronic
919712038 1:200738758-200738780 CCCCGCCCGCGCCCGGGATTCGG - Intergenic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
924534084 1:244918926-244918948 CCACGTGCGCGCGGGGGCTGCGG + Intergenic
1064410121 10:15097487-15097509 CCCTGCGTGCGCGCGGGCTTCGG - Exonic
1065214701 10:23438881-23438903 CCGCGCGCGCTCGCGCGCCGAGG + Intergenic
1065390513 10:25176469-25176491 CCACGCGGGCGCGGGTGCTTGGG + Intronic
1067572778 10:47384164-47384186 CCGCGAGCGGGCGCGGGCGGCGG - Intronic
1071086828 10:81875248-81875270 GCGGGCGCGGGCGCGGGCTCCGG - Intergenic
1071086829 10:81875254-81875276 CCGGGCGCGGGCGCGGGCGCGGG - Intergenic
1073577840 10:104640577-104640599 CCGCGCGGGGGCGCAGGCCTTGG + Intergenic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1075877860 10:125822972-125822994 CCCTGCACGCCCGCGGGCTTCGG + Intronic
1077545042 11:3165474-3165496 CGGAGCGCGCGCGGGGGGTTGGG - Intronic
1082775670 11:57242597-57242619 GCGCGCACGCGCGCGTGCCTAGG - Intergenic
1083648197 11:64185393-64185415 CCGCGAGGGCGCTTGGGCTTGGG - Exonic
1083879495 11:65540995-65541017 CTGAGCGCGCGCGTGGGCTTAGG + Intronic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1089713671 11:120336325-120336347 GCGGGCGCGCGCGCGGGTTCCGG - Intergenic
1089966161 11:122656247-122656269 CCGCGCGCGCGGCCGGCCCTCGG + Intronic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1090285602 11:125496308-125496330 CCGCGCTCGTGCCCGGGCTCCGG + Exonic
1092861894 12:12725641-12725663 CCGGGCGGGCGCGGGGGCTGGGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1100539903 12:95548401-95548423 ACGGGCGCGGGCGAGGGCTTCGG - Intronic
1102084395 12:110124283-110124305 GCGCGCGCGCGCACGAGCTGGGG - Intergenic
1102651966 12:114448538-114448560 GTGCGCGCGCGCCAGGGCTTAGG - Intergenic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1107078228 13:36346355-36346377 AAGCGCGCGCGCGAGGCCTTGGG - Intronic
1107549042 13:41457961-41457983 CTCCGCGCGCGCCCGGGGTTGGG + Intronic
1108408083 13:50124567-50124589 GAGAGCGCGCGCGCGGGCTTCGG - Intronic
1110860515 13:80341036-80341058 CCGGGCGGGCGCGGGGGCCTGGG + Intergenic
1112344357 13:98577311-98577333 CCGCCCGCCCGCGGGGGCGTGGG - Intronic
1112494681 13:99895604-99895626 CCGCGGGCGAGCCCGCGCTTGGG + Exonic
1112504630 13:99968609-99968631 CCGCGCGCGGCCCCGCGCTTGGG + Intronic
1113437882 13:110307348-110307370 ACGCGCGGGCGCGAGGGGTTGGG - Exonic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1122975105 14:105167813-105167835 CCGAGCGCGGGCGCGGGCCCGGG - Exonic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1125535551 15:40439882-40439904 CCGCGAGCGTGCTCGGGCTTGGG + Intronic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1126767053 15:52019604-52019626 CCGCGCGGGCGGGCGGGCGGCGG + Intronic
1127103301 15:55588441-55588463 CCCCGCGCGGGGACGGGCTTCGG + Intronic
1127931645 15:63600988-63601010 CGGCGGGCGCGCGCGGGCGCGGG - Intronic
1132055548 15:98648510-98648532 TCGCGCGCGCGCGCGCGCCCTGG - Intergenic
1132589788 16:721602-721624 CCGCGCGCTCGCGCCGACGTAGG - Exonic
1132875627 16:2135722-2135744 CTCCGCGCGCGGGCGGGCCTGGG - Exonic
1132991754 16:2799010-2799032 CCGCGCGCGGGCGCTGGCCATGG + Intergenic
1133340666 16:5033677-5033699 GCGCGCGCGCGCGCGTGGATAGG + Exonic
1134070054 16:11255359-11255381 CCGCGGGCGCGCGGGGGCCGCGG + Exonic
1134519359 16:14911631-14911653 CTCCGCGCGCGGGCGGGCCTGGG + Intronic
1134554574 16:15154597-15154619 CTCCGCGCGCGGGCGGGCCTGGG - Intergenic
1134707029 16:16310286-16310308 CTCCGCGCGCGGGCGGGCCTGGG + Intergenic
1134960511 16:18401838-18401860 CTCCGCGCGCGGGCGGGCCTGGG - Intergenic
1136111082 16:28063823-28063845 CCGGGCGCGGGCGGGGGCCTGGG + Intergenic
1136399873 16:30011443-30011465 CCGCGCGCGCGGGCGGGGGCGGG - Intronic
1137454732 16:48609742-48609764 CCGCGGGCGCGCGGGGGCGGCGG + Intronic
1138178708 16:54928780-54928802 CCGCGCGGGCGCGCGGGCCGCGG + Intergenic
1138619147 16:58197891-58197913 CCGCGGGGGCGGGCGGGCTGGGG + Exonic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1140462244 16:75148959-75148981 CCGCGCGCGCGCGCCCGCCGGGG - Intronic
1144438320 17:15260871-15260893 CCGCGCGGGCGGTCGGGCTGCGG - Intronic
1144519561 17:15944977-15944999 CCCCGCGCGGGCGCGAACTTTGG + Exonic
1144724498 17:17495031-17495053 CCGCGCGCGCTCCCGGCCTGGGG + Exonic
1146053008 17:29567465-29567487 CCGCGCGCGCGCTCTGCCCTCGG + Intronic
1148157201 17:45431218-45431240 CCCCGCTCCCGCCCGGGCTTCGG + Intronic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1152708940 17:81860593-81860615 CCGCCCGCGCGCGCTGGCCGCGG + Exonic
1152823801 17:82450810-82450832 CCGCGCGCGCTTCCGGGATTGGG + Intronic
1152823812 17:82450840-82450862 CCGCGCGCGCTTACGGGATTGGG + Intergenic
1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG + Intronic
1161707238 19:5827853-5827875 CGGCGCGCGCGTGCGCGGTTGGG + Exonic
1161802583 19:6424400-6424422 TCGCGCGCGCGCGCAGGCGGGGG - Intronic
1162095660 19:8308347-8308369 GCACGCGCACGCGCGGGGTTGGG + Exonic
1162778690 19:12995751-12995773 CCGCGCTCGGGCTCGGGCTCCGG - Exonic
1163443517 19:17333664-17333686 GCGGGCGGGCGGGCGGGCTTGGG + Intronic
1163649607 19:18509572-18509594 GCGCGCGCGCGCACGTGCATTGG - Intronic
1165080002 19:33301690-33301712 CCGAGCGCGGGCGCGGGGTGCGG + Exonic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1168667702 19:58217114-58217136 CGGGCCGCGCGCGCGGGCTTTGG - Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926077377 2:9951935-9951957 CCGCCCGCCCGCGCGGCCTCGGG - Intronic
926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG + Intronic
927652439 2:24920453-24920475 GCGGGCGCGGGCGCGGGCGTGGG + Intergenic
928093590 2:28391122-28391144 GCGCACGCGCGCGCGTCCTTGGG + Intergenic
929033705 2:37671800-37671822 CCGCGCGCGCGCCCGGCCACCGG - Exonic
929033714 2:37671807-37671829 CCGGGCGCGCGCGCGGGGGGGGG + Exonic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
933206376 2:79512796-79512818 CCGCGGGCGCGCGCGGCCTGGGG - Intronic
933724435 2:85418650-85418672 ACGCGCGCGCGCGCGCCTTTTGG + Intergenic
935815524 2:106843185-106843207 CCGCGCGCGCGTGCGGACGCTGG - Exonic
936569444 2:113602375-113602397 CCGGGCGGGCGGGCGGGCTGAGG + Intergenic
940639635 2:156333019-156333041 CTGCGCGGGCGCAGGGGCTTCGG - Intronic
941111607 2:161423517-161423539 CCGGGCGCGGGCGCGGGCCCCGG + Exonic
942046634 2:172102779-172102801 CCCAGCGCGAGCGCGGGCTCTGG + Exonic
948645342 2:239400771-239400793 CGGCGCGCGGGCTCGGGCTCGGG + Exonic
949032511 2:241803766-241803788 CCGCGCGCGCTCCCGGGTCTCGG - Exonic
1170756818 20:19212511-19212533 CCGCGCCCGCGCTCGGCCTGGGG - Intergenic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1180908549 22:19432242-19432264 CTGCGCCCTCGCGCGGGCCTCGG - Exonic
1181413296 22:22740185-22740207 GCGCGTGCGCGCGCGCTCTTTGG - Intronic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1183942113 22:41301833-41301855 CCGCCCGCGCGCGAGGGTTCGGG + Intronic
951080293 3:18444671-18444693 CCGGGCGGGCGCGCCGGCGTCGG + Intronic
954795920 3:53161347-53161369 CGGCGCGCGCGGACGGGGTTCGG - Exonic
956080247 3:65549450-65549472 CCGAGCGCGCGCCTGGGCTCCGG - Intronic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966592230 3:181695790-181695812 ACGCGCGCGCGCGCGTTCTCGGG + Intergenic
966936335 3:184712032-184712054 CCTCGCGCGGGCGCGGACTGAGG - Intergenic
968178192 3:196569048-196569070 GCGGGCGCGGGCGCGGGCTCGGG + Exonic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
969379015 4:6782515-6782537 CTGCGGGCGCGCGCGGGCGGTGG - Intronic
974047125 4:56907830-56907852 TCGCGGGCGCGCGCGGGCGTCGG + Intergenic
975373930 4:73620452-73620474 CCCTGCGCCCGCGCGGGCCTCGG - Exonic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
983937012 4:173509237-173509259 GCGCGCGCGTGCGGGAGCTTCGG + Intergenic
984698225 4:182800129-182800151 GCGCGCGCTCGCCCGGGCCTGGG + Exonic
987303420 5:16617006-16617028 GCGCGCGCGCGGGCGCGCCTGGG + Exonic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
988949321 5:36241623-36241645 CCGCGCGAGCTGGCGGGCTGTGG - Exonic
997237157 5:132279336-132279358 GCGCGCGCGCGCGTGGGTGTCGG - Intronic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
997963271 5:138338388-138338410 CCGCGCGGGCGGTCGGGCTGGGG - Intronic
998083356 5:139294468-139294490 CCGCGCGCGCGCGCGCGTGTGGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998583227 5:143402750-143402772 CCGAGCGCGAGCCCGGGCTCCGG - Intronic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002709970 5:181189539-181189561 CCGCGGGAGCGCGCGCGCGTGGG - Intergenic
1004229068 6:13814559-13814581 CCGGGCGCGCGGGCGGGGCTCGG + Exonic
1004722204 6:18277460-18277482 CCCCGAGCGCGCGCGCGCCTTGG + Intergenic
1006121164 6:31806827-31806849 CCACGCGCGGGCTCGCGCTTCGG - Exonic
1006606250 6:35259735-35259757 GCGCGCGGGCGGGCGGGCTATGG + Exonic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1007479795 6:42142449-42142471 CCTGGCGCCCGCGCGGGCTGCGG - Intronic
1010249879 6:73696313-73696335 GCGCGCGGGCGCGCGGGCCTGGG + Intronic
1011112438 6:83853489-83853511 CGGCGCGCGGGCGCGGACTCCGG + Exonic
1012872901 6:104693059-104693081 ACGCGCGCGCGCGCTGGGGTGGG + Intergenic
1013576054 6:111483844-111483866 GGGCGCGCGGGCGCGGGCTTCGG + Intergenic
1016340919 6:143060816-143060838 CCGGGCGCGGGCGCGGGCGCGGG - Intronic
1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG + Exonic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1035212265 7:157337178-157337200 CCGGGCGCGCGCGGGGCCCTAGG - Intronic
1035747551 8:1973489-1973511 CCGCGCGTGGGCGCGGGCTCGGG + Intergenic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1038575598 8:28701447-28701469 CCGCTCGCGAACGCCGGCTTCGG + Exonic
1038727668 8:30095615-30095637 CCGGGCTCGCGCGCGCGCGTGGG + Intronic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1047292467 8:123541744-123541766 CCGCGCGCTAGGGCGGGGTTGGG - Intergenic
1048307981 8:133296963-133296985 GCGCGGGCGCGAGGGGGCTTTGG - Exonic
1051174364 9:14347883-14347905 CCGAGCGCGCGCGCGCGCCAGGG + Intronic
1053435168 9:38069303-38069325 CGGGGCGCGCGAGCGGGCTCCGG - Intergenic
1054842663 9:69760020-69760042 GCGCGCGCGCGCGGGTGCTTCGG + Intergenic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1055611581 9:78030936-78030958 CCGCGCGCCCGCGCGGGTGAAGG + Intronic
1057995914 9:99821683-99821705 GCGCGCGCGCGCGCGTTCCTCGG - Intergenic
1058439232 9:104991876-104991898 CGGCGCGCGTGCGCGGGGCTGGG + Intergenic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059790038 9:117632135-117632157 GCGCGCGCGCGCGCGTGTATTGG - Intergenic
1060713058 9:125889864-125889886 GCGCGAGCGCGGGCGGGCGTCGG - Intronic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1187904650 X:24054639-24054661 CCCGGCGCGCGCGCTGGCCTGGG - Intergenic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1200233540 X:154457985-154458007 GCGCGGGCGCGCGCGGGTTCCGG + Intergenic