ID: 1199760225

View in Genome Browser
Species Human (GRCh38)
Location X:150899028-150899050
Sequence CGGGAGGCGGCAGCGCCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199760211_1199760225 16 Left 1199760211 X:150898989-150899011 CCCGCGGACCTGGAGCAGTGAGT No data
Right 1199760225 X:150899028-150899050 CGGGAGGCGGCAGCGCCGGTGGG No data
1199760220_1199760225 -9 Left 1199760220 X:150899014-150899036 CCAGTGCCGGGGAGCGGGAGGCG No data
Right 1199760225 X:150899028-150899050 CGGGAGGCGGCAGCGCCGGTGGG No data
1199760213_1199760225 8 Left 1199760213 X:150898997-150899019 CCTGGAGCAGTGAGTCACCAGTG No data
Right 1199760225 X:150899028-150899050 CGGGAGGCGGCAGCGCCGGTGGG No data
1199760212_1199760225 15 Left 1199760212 X:150898990-150899012 CCGCGGACCTGGAGCAGTGAGTC No data
Right 1199760225 X:150899028-150899050 CGGGAGGCGGCAGCGCCGGTGGG No data
1199760210_1199760225 17 Left 1199760210 X:150898988-150899010 CCCCGCGGACCTGGAGCAGTGAG No data
Right 1199760225 X:150899028-150899050 CGGGAGGCGGCAGCGCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199760225 Original CRISPR CGGGAGGCGGCAGCGCCGGT GGG Intergenic
No off target data available for this crispr