ID: 1199760234

View in Genome Browser
Species Human (GRCh38)
Location X:150899064-150899086
Sequence GAGCCCTTCTCAAGGTCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199760234_1199760241 6 Left 1199760234 X:150899064-150899086 CCGGGTGACCTTGAGAAGGGCTC No data
Right 1199760241 X:150899093-150899115 TTCTGGCCTTGGTGTTCTCCCGG No data
1199760234_1199760244 13 Left 1199760234 X:150899064-150899086 CCGGGTGACCTTGAGAAGGGCTC No data
Right 1199760244 X:150899100-150899122 CTTGGTGTTCTCCCGGTGAAGGG No data
1199760234_1199760243 12 Left 1199760234 X:150899064-150899086 CCGGGTGACCTTGAGAAGGGCTC No data
Right 1199760243 X:150899099-150899121 CCTTGGTGTTCTCCCGGTGAAGG No data
1199760234_1199760248 26 Left 1199760234 X:150899064-150899086 CCGGGTGACCTTGAGAAGGGCTC No data
Right 1199760248 X:150899113-150899135 CGGTGAAGGGTTGTTCCCTTGGG No data
1199760234_1199760237 -5 Left 1199760234 X:150899064-150899086 CCGGGTGACCTTGAGAAGGGCTC No data
Right 1199760237 X:150899082-150899104 GGCTCTTCCCCTTCTGGCCTTGG No data
1199760234_1199760247 25 Left 1199760234 X:150899064-150899086 CCGGGTGACCTTGAGAAGGGCTC No data
Right 1199760247 X:150899112-150899134 CCGGTGAAGGGTTGTTCCCTTGG No data
1199760234_1199760249 27 Left 1199760234 X:150899064-150899086 CCGGGTGACCTTGAGAAGGGCTC No data
Right 1199760249 X:150899114-150899136 GGTGAAGGGTTGTTCCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199760234 Original CRISPR GAGCCCTTCTCAAGGTCACC CGG (reversed) Intergenic
No off target data available for this crispr