ID: 1199766722

View in Genome Browser
Species Human (GRCh38)
Location X:150946802-150946824
Sequence AACCAGCCTGGGCTCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199766722_1199766728 13 Left 1199766722 X:150946802-150946824 CCCACCTGGAGCCCAGGCTGGTT No data
Right 1199766728 X:150946838-150946860 CTCAAGTGATCCTCCCACCTTGG 0: 3128
1: 16752
2: 53796
3: 88890
4: 101828

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199766722 Original CRISPR AACCAGCCTGGGCTCCAGGT GGG (reversed) Intergenic
No off target data available for this crispr