ID: 1199771129

View in Genome Browser
Species Human (GRCh38)
Location X:150976029-150976051
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199771129_1199771138 23 Left 1199771129 X:150976029-150976051 CCTTTGGTCACTGACCCACTTCC No data
Right 1199771138 X:150976075-150976097 AACCCAGAGCAGGGACGCGGTGG No data
1199771129_1199771136 14 Left 1199771129 X:150976029-150976051 CCTTTGGTCACTGACCCACTTCC No data
Right 1199771136 X:150976066-150976088 TATGAAAGGAACCCAGAGCAGGG No data
1199771129_1199771137 20 Left 1199771129 X:150976029-150976051 CCTTTGGTCACTGACCCACTTCC No data
Right 1199771137 X:150976072-150976094 AGGAACCCAGAGCAGGGACGCGG No data
1199771129_1199771134 0 Left 1199771129 X:150976029-150976051 CCTTTGGTCACTGACCCACTTCC No data
Right 1199771134 X:150976052-150976074 CGCTTTTCATTCAATATGAAAGG No data
1199771129_1199771141 29 Left 1199771129 X:150976029-150976051 CCTTTGGTCACTGACCCACTTCC No data
Right 1199771141 X:150976081-150976103 GAGCAGGGACGCGGTGGCGCTGG No data
1199771129_1199771135 13 Left 1199771129 X:150976029-150976051 CCTTTGGTCACTGACCCACTTCC No data
Right 1199771135 X:150976065-150976087 ATATGAAAGGAACCCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199771129 Original CRISPR GGAAGTGGGTCAGTGACCAA AGG (reversed) Intergenic