ID: 1199771133

View in Genome Browser
Species Human (GRCh38)
Location X:150976051-150976073
Sequence CTTTCATATTGAATGAAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199771133_1199771137 -2 Left 1199771133 X:150976051-150976073 CCGCTTTTCATTCAATATGAAAG No data
Right 1199771137 X:150976072-150976094 AGGAACCCAGAGCAGGGACGCGG No data
1199771133_1199771141 7 Left 1199771133 X:150976051-150976073 CCGCTTTTCATTCAATATGAAAG No data
Right 1199771141 X:150976081-150976103 GAGCAGGGACGCGGTGGCGCTGG No data
1199771133_1199771142 21 Left 1199771133 X:150976051-150976073 CCGCTTTTCATTCAATATGAAAG No data
Right 1199771142 X:150976095-150976117 TGGCGCTGGTGCTGCTGAAGAGG No data
1199771133_1199771136 -8 Left 1199771133 X:150976051-150976073 CCGCTTTTCATTCAATATGAAAG No data
Right 1199771136 X:150976066-150976088 TATGAAAGGAACCCAGAGCAGGG No data
1199771133_1199771135 -9 Left 1199771133 X:150976051-150976073 CCGCTTTTCATTCAATATGAAAG No data
Right 1199771135 X:150976065-150976087 ATATGAAAGGAACCCAGAGCAGG No data
1199771133_1199771138 1 Left 1199771133 X:150976051-150976073 CCGCTTTTCATTCAATATGAAAG No data
Right 1199771138 X:150976075-150976097 AACCCAGAGCAGGGACGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199771133 Original CRISPR CTTTCATATTGAATGAAAAG CGG (reversed) Intergenic