ID: 1199771138

View in Genome Browser
Species Human (GRCh38)
Location X:150976075-150976097
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199771133_1199771138 1 Left 1199771133 X:150976051-150976073 CCGCTTTTCATTCAATATGAAAG No data
Right 1199771138 X:150976075-150976097 AACCCAGAGCAGGGACGCGGTGG No data
1199771131_1199771138 8 Left 1199771131 X:150976044-150976066 CCACTTCCCGCTTTTCATTCAAT No data
Right 1199771138 X:150976075-150976097 AACCCAGAGCAGGGACGCGGTGG No data
1199771130_1199771138 9 Left 1199771130 X:150976043-150976065 CCCACTTCCCGCTTTTCATTCAA No data
Right 1199771138 X:150976075-150976097 AACCCAGAGCAGGGACGCGGTGG No data
1199771132_1199771138 2 Left 1199771132 X:150976050-150976072 CCCGCTTTTCATTCAATATGAAA No data
Right 1199771138 X:150976075-150976097 AACCCAGAGCAGGGACGCGGTGG No data
1199771129_1199771138 23 Left 1199771129 X:150976029-150976051 CCTTTGGTCACTGACCCACTTCC No data
Right 1199771138 X:150976075-150976097 AACCCAGAGCAGGGACGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199771138 Original CRISPR AACCCAGAGCAGGGACGCGG TGG Intergenic