ID: 1199771142

View in Genome Browser
Species Human (GRCh38)
Location X:150976095-150976117
Sequence TGGCGCTGGTGCTGCTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199771139_1199771142 -5 Left 1199771139 X:150976077-150976099 CCCAGAGCAGGGACGCGGTGGCG No data
Right 1199771142 X:150976095-150976117 TGGCGCTGGTGCTGCTGAAGAGG No data
1199771140_1199771142 -6 Left 1199771140 X:150976078-150976100 CCAGAGCAGGGACGCGGTGGCGC No data
Right 1199771142 X:150976095-150976117 TGGCGCTGGTGCTGCTGAAGAGG No data
1199771133_1199771142 21 Left 1199771133 X:150976051-150976073 CCGCTTTTCATTCAATATGAAAG No data
Right 1199771142 X:150976095-150976117 TGGCGCTGGTGCTGCTGAAGAGG No data
1199771131_1199771142 28 Left 1199771131 X:150976044-150976066 CCACTTCCCGCTTTTCATTCAAT No data
Right 1199771142 X:150976095-150976117 TGGCGCTGGTGCTGCTGAAGAGG No data
1199771130_1199771142 29 Left 1199771130 X:150976043-150976065 CCCACTTCCCGCTTTTCATTCAA No data
Right 1199771142 X:150976095-150976117 TGGCGCTGGTGCTGCTGAAGAGG No data
1199771132_1199771142 22 Left 1199771132 X:150976050-150976072 CCCGCTTTTCATTCAATATGAAA No data
Right 1199771142 X:150976095-150976117 TGGCGCTGGTGCTGCTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199771142 Original CRISPR TGGCGCTGGTGCTGCTGAAG AGG Intergenic