ID: 1199772012

View in Genome Browser
Species Human (GRCh38)
Location X:150981137-150981159
Sequence AACTGCTTGTAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199771998_1199772012 29 Left 1199771998 X:150981085-150981107 CCTTGTGGAGACAGGGGAAGAGG 0: 1
1: 0
2: 7
3: 105
4: 784
Right 1199772012 X:150981137-150981159 AACTGCTTGTAGAAGGAGCAGGG 0: 1
1: 0
2: 1
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199772012 Original CRISPR AACTGCTTGTAGAAGGAGCA GGG Intronic
905257908 1:36696880-36696902 AACTCGTGGTGGAAGGAGCAAGG + Intergenic
906003566 1:42448346-42448368 GACCTATTGTAGAAGGAGCAGGG - Intronic
907706257 1:56835069-56835091 CACAGATGGTAGAAGGAGCAAGG - Intergenic
908481806 1:64547796-64547818 AACTACTTGAGGAAGGAGAAGGG + Intronic
911019912 1:93375700-93375722 CTCTGCTTGTAGAAAGAGGAGGG + Intergenic
911452576 1:98083711-98083733 AACTCAGTGTAGAAGCAGCAAGG - Intergenic
913203049 1:116511733-116511755 GACTGGTTTTAGGAGGAGCAAGG + Intergenic
916079242 1:161222194-161222216 ATCTGCTTCTAGAAGGAGAGAGG - Intergenic
916451607 1:164926471-164926493 AACTGCTTGAGGAAGTAGCCAGG - Intergenic
917455374 1:175181690-175181712 AAATGCTTATGGAAGTAGCAAGG + Intronic
917818452 1:178735508-178735530 AACTGCTTGAAGCAGGACCTGGG - Intronic
921040081 1:211422674-211422696 AACTGGTTGTTGAAAGAGCCTGG - Intergenic
922351881 1:224740944-224740966 AACTGGATGTAGAAGGTGAATGG + Intergenic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
1063013952 10:2055776-2055798 ATCTGCTTTTAGAAGGAGCTGGG + Intergenic
1063280359 10:4622413-4622435 AAATGCTTTTAGAAGTAGGAAGG - Intergenic
1067819758 10:49518365-49518387 AAGGGCTTGGAGAAGGAGAAGGG - Intronic
1068605551 10:59001145-59001167 AACTGCTAGTTCAAGAAGCAGGG + Intergenic
1069666121 10:70160928-70160950 CACTGCTTTTAAAAGGAGCTGGG + Intronic
1069853286 10:71424344-71424366 CACAGCTTCTAAAAGGAGCAAGG - Intronic
1069862030 10:71477516-71477538 AAAGGATTGTAGAGGGAGCAGGG - Intronic
1072008778 10:91285583-91285605 CAGAGCTTGTAGGAGGAGCAGGG - Intergenic
1073352990 10:102832862-102832884 TACTGCTTGGGTAAGGAGCAGGG + Intronic
1073469423 10:103713679-103713701 AACTGATTGTAATAGGTGCAGGG - Intronic
1073697261 10:105883759-105883781 AACTGGCTGTAGAAGGTACAAGG - Intergenic
1074609909 10:115011691-115011713 AACTGATTGTTGAAAGAGAATGG - Intergenic
1075003215 10:118812917-118812939 AACTGCTTGTGGAACGGGTATGG - Intergenic
1076519339 10:131071025-131071047 CACTGCATGGAGGAGGAGCAAGG + Intergenic
1078499847 11:11860839-11860861 AACAGCTATTAAAAGGAGCAAGG + Intronic
1078694865 11:13620806-13620828 AGCTGCTTGAAGAAGTGGCAGGG - Intergenic
1079152089 11:17909075-17909097 AGATGCTGGTAGAAGGAGCCAGG + Intronic
1079566300 11:21887468-21887490 AACTGCTTCTACCAGGTGCATGG + Intergenic
1081379244 11:42394719-42394741 AACTGCTTATAGAGGTAGTAGGG + Intergenic
1081615642 11:44589503-44589525 CAGTGCTTGCAGAAGCAGCAAGG - Intronic
1087009663 11:93501411-93501433 TACGGCTTCTAGAGGGAGCATGG - Intronic
1089851361 11:121499504-121499526 ATCTGCCTGTAGAAGGCTCAGGG - Intronic
1090595818 11:128319917-128319939 AATTCCTTATATAAGGAGCATGG - Intergenic
1092955201 12:13543174-13543196 AAAAGGTTATAGAAGGAGCAGGG - Exonic
1093318443 12:17681010-17681032 AACAGATTTTAGAAGGAGCAAGG + Intergenic
1093685490 12:22049161-22049183 GACTGGTTGAAGAATGAGCAGGG - Intronic
1095885736 12:47186691-47186713 TACAGCTTTCAGAAGGAGCATGG + Intronic
1099115123 12:78614530-78614552 ACCTCCTTCAAGAAGGAGCAAGG - Intergenic
1102149114 12:110676488-110676510 GACTGCTTGTGGAAACAGCATGG + Intronic
1102220049 12:111188143-111188165 AAATGCTTGCTGAAGGAACAAGG - Intronic
1102645726 12:114402584-114402606 AACTACTTGTAGAGAGAGCCTGG - Intronic
1104648188 12:130511877-130511899 AGCTGCCTGGAGAAGGAGCCAGG - Intronic
1106465161 13:30006916-30006938 CAGTGCTTTCAGAAGGAGCACGG + Intergenic
1106588093 13:31074455-31074477 TACTGTTTGTTGAAGGAGAAAGG + Intergenic
1107497061 13:40936858-40936880 AACTGCTTGAACCAGGAGCTGGG + Intronic
1108564277 13:51679755-51679777 TACAGCTTTCAGAAGGAGCATGG - Intronic
1109479287 13:62928158-62928180 AACTGCTTGTAGAATTGGCAGGG + Intergenic
1109529815 13:63627363-63627385 AACTGCTTGCAGAAGAAGCAAGG + Intergenic
1110263706 13:73514776-73514798 AAGTGTTTGTAGAAAGCGCAGGG + Intergenic
1110309474 13:74031630-74031652 CACTGCTTGTAGATGGAAGAAGG - Intronic
1113476190 13:110582944-110582966 AACTAACTGTAGCAGGAGCAGGG - Intergenic
1114426737 14:22630106-22630128 CACTTCTGGTAGAAAGAGCATGG + Intergenic
1116040569 14:39681443-39681465 TACTGCTGTTAGAAGGGGCATGG - Intergenic
1116860097 14:49988300-49988322 AACAACTTATACAAGGAGCATGG - Intronic
1119739483 14:77005015-77005037 AACTTCTTGTAAATGGAGCTGGG - Intergenic
1120263004 14:82212332-82212354 AACTGGTTGTGGAAAGAGCCTGG + Intergenic
1121826450 14:97013675-97013697 AGCTGCTTACAGAAGGAACATGG + Intergenic
1123145191 14:106122929-106122951 AAATGTTTGTAAATGGAGCAGGG - Intergenic
1127638718 15:60895050-60895072 AACTGCTTGAGGAATGAGCATGG - Intronic
1128364541 15:66988417-66988439 CTCTGCTTGTAGAAGAAGAAGGG + Intergenic
1130760832 15:86818027-86818049 TACAGTTTCTAGAAGGAGCATGG + Intronic
1132318416 15:100907591-100907613 AACTGCTTTTAGAATCAGAATGG - Intronic
1133162406 16:3920714-3920736 AACTGCCTGCAGAAGGAAGAGGG - Intergenic
1136693910 16:32058855-32058877 AAATGTTTGTAAATGGAGCAGGG + Intergenic
1136794402 16:33002091-33002113 AAATGTTTGTAAATGGAGCAGGG + Intergenic
1136875507 16:33852289-33852311 AAATGTTTGTAAATGGAGCAGGG - Intergenic
1137486548 16:48895955-48895977 AACATCTTATATAAGGAGCATGG + Intergenic
1137544306 16:49389719-49389741 AACAGCATGTAGAAGGGGAAAGG - Intronic
1140671616 16:77285142-77285164 AAGTGCATGTTGTAGGAGCAAGG + Intronic
1141429950 16:83966284-83966306 ACCTGCTTCTGGAAGGCGCAGGG - Exonic
1203096666 16_KI270728v1_random:1263771-1263793 AAATGTTTGTAAATGGAGCAGGG + Intergenic
1144180254 17:12745085-12745107 TTCTGCTTTTAGAAGGAACAGGG + Intronic
1144371453 17:14595463-14595485 AAGTGCTTGTAGAGGGAACAGGG + Intergenic
1146228388 17:31087714-31087736 AGCTGCTTGAAGAAGTATCAGGG + Intergenic
1146782867 17:35691279-35691301 AACTACATGTAGGAGTAGCAAGG - Intronic
1146859617 17:36285796-36285818 AATTGCCTGGGGAAGGAGCAAGG - Intronic
1147089941 17:38089883-38089905 AATTGCCTGGGGAAGGAGCAAGG - Intergenic
1147107270 17:38230638-38230660 AATTGCCTGGGGAAGGAGCAAGG + Intergenic
1148203147 17:45763240-45763262 AGCTGCTGGTAAGAGGAGCAGGG - Intergenic
1148422255 17:47557898-47557920 AATTGCCTGGGGAAGGAGCAAGG - Intronic
1150145510 17:62765825-62765847 ATCTGGCTGTAGCAGGAGCAGGG + Intronic
1151063195 17:71120417-71120439 AACTACTTCTATGAGGAGCACGG + Intergenic
1153735743 18:8065272-8065294 GACTGAATGTAGAAGGAGCCAGG + Intronic
1154497787 18:14975116-14975138 TAGTGCTTGTGCAAGGAGCAGGG - Intergenic
1155434554 18:25798082-25798104 AACTGCCTGCAGATGCAGCAAGG - Intergenic
1155910703 18:31501513-31501535 AACTGGTTTCAGAGGGAGCATGG - Intronic
1159237224 18:65692467-65692489 GAGTGCTTGTAGAATGACCATGG + Intergenic
1159247470 18:65828021-65828043 AACTACGTGGAGAAGGAGGAGGG - Intronic
1159945937 18:74445004-74445026 ATCTGCTTCTCGAAGGAGCTGGG - Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165462443 19:35952065-35952087 AGCTGCCTGTGGAAGGAGCTGGG + Intergenic
1167466972 19:49655231-49655253 ACCTGTTTGTAGATGAAGCAGGG + Intronic
1168401198 19:56087153-56087175 AGCTGCTTGTAGATGGGGCAGGG - Intergenic
925159258 2:1672472-1672494 CGCTGCTCATAGAAGGAGCATGG - Intronic
926868586 2:17387281-17387303 AACTGGTAGGAGAAGAAGCAGGG + Intergenic
927084252 2:19658804-19658826 AACTGCTTGATTAAGGAGGAAGG - Intergenic
927159379 2:20243035-20243057 AACTGACTTTTGAAGGAGCAGGG + Intergenic
929585741 2:43113208-43113230 AAGTCCCTGTAGTAGGAGCAGGG - Intergenic
929694814 2:44105557-44105579 AACTGCTTCAACAAGGACCAGGG - Intergenic
929731989 2:44504886-44504908 TACAGCTTGTACAAGAAGCATGG + Intronic
930248728 2:49011825-49011847 AACTGCTTTTGGAGGTAGCACGG - Intronic
930482723 2:51969851-51969873 AACTGCAAGTAGAAGGAGCTTGG - Intergenic
932790776 2:74653161-74653183 AAGTGCTTGAAGAAGGAGCTAGG + Intergenic
933044448 2:77518288-77518310 AAATGCTTTTAGGAGGATCATGG + Intronic
935750010 2:106223599-106223621 AACTGGTTGTTAAAGGAGCCTGG - Intergenic
936226802 2:110661968-110661990 GAATGCTTGAAGAAGGAGTATGG - Intronic
937977604 2:127591282-127591304 AACTGCTGGGAGAAGTAGCTGGG + Intronic
938595140 2:132781263-132781285 GAGTGATTGAAGAAGGAGCAAGG - Intronic
939872879 2:147544456-147544478 CAATGCTTGTAGCAGGAGAAAGG - Intergenic
940534808 2:154927240-154927262 AAGTGTTTCTAGAAGGAGAATGG + Intergenic
946389768 2:219408488-219408510 CCCTCCTTGGAGAAGGAGCAAGG + Intergenic
947506487 2:230712107-230712129 AACTGTTTGTGCTAGGAGCATGG + Intergenic
1171306231 20:24108896-24108918 AGCTGCTTGGAGTAGGAGCTAGG + Intergenic
1173693986 20:44991548-44991570 AACTGCTTTGAGAAATAGCAGGG - Intronic
1173710240 20:45149216-45149238 AACTGTTTCTAGGAGGAGCATGG + Intergenic
1179081038 21:38170783-38170805 AGAAGCTTCTAGAAGGAGCATGG - Intronic
1181589646 22:23876317-23876339 AAATGTTTGTAGGAAGAGCAGGG + Intronic
1181967256 22:26665908-26665930 AACTGCTATTAGAAGGAGGCTGG + Intergenic
1182426198 22:30274230-30274252 AACAGCTTGGGGAAGGAGCCAGG + Intergenic
1183033875 22:35126139-35126161 AGCTCCTTGTAGCTGGAGCACGG + Intergenic
949743682 3:7264368-7264390 AACTGCTTGGAGAAGTGGTAGGG - Intronic
950235807 3:11319383-11319405 AAGTGCTGGTAGGAGGAGGAGGG - Intronic
951107257 3:18759533-18759555 ATCTTATGGTAGAAGGAGCATGG - Intergenic
951694113 3:25428010-25428032 AAGTGCTTTTAAAATGAGCAGGG - Intronic
954993105 3:54857889-54857911 ATTTGCTTGTAGAAGTACCAAGG + Intronic
955373647 3:58375288-58375310 AACTGATTGTATATGGAGCAAGG - Intronic
955650095 3:61184727-61184749 AGATGCTTGTAGATGGAGAAGGG - Intronic
956654382 3:71535041-71535063 CAATGCTTGGAGAAGGAGCAGGG + Intronic
959044493 3:101457636-101457658 AACTGCTCGTAGAAGGAAGAAGG - Intronic
960258235 3:115533729-115533751 AACTGCTTAGAGAAGTAGCAGGG - Intergenic
960317839 3:116199991-116200013 AAATGAATGTAGAAGGAGCTGGG + Intronic
961438071 3:126932938-126932960 TACTGCTTCTGAAAGGAGCATGG + Intronic
962228257 3:133634716-133634738 AACAATTTGTAGAAGAAGCAAGG + Intronic
963106327 3:141650642-141650664 AACTGCTTGAACAAGGACCCAGG + Intergenic
964221017 3:154344771-154344793 AAGAGCTTATAGAGGGAGCATGG + Intronic
965317393 3:167209074-167209096 CTCTGCTTGTAGAAAGAGAAGGG + Intergenic
967421482 3:189278118-189278140 AAGGGCATGTGGAAGGAGCATGG - Intronic
969335410 4:6506192-6506214 AACTGATTGAAAGAGGAGCAAGG + Intronic
972123895 4:35740117-35740139 AGCTGCTTAGAGAAGTAGCAGGG + Intergenic
972823572 4:42730753-42730775 AGATGCTTGGAGAAGGAGCAGGG + Intergenic
974625880 4:64428754-64428776 AAATGCTTTTAGAAGCAGCCAGG - Intergenic
975962148 4:79923793-79923815 AAATATTTGTAGAAGAAGCATGG + Intronic
979497357 4:121398237-121398259 ACCTGCCTGGAGAAGGAGGAAGG + Intergenic
984632733 4:182077809-182077831 AACTGCATGTACAAGGATCCTGG + Intergenic
985613110 5:901493-901515 AACTCCTTGCAGAAGGACGAAGG - Intronic
988290984 5:29286408-29286430 AACCACTTGAAGAATGAGCATGG + Intergenic
988617015 5:32784778-32784800 ACCTGCTTGAAAAAGAAGCATGG - Exonic
988768707 5:34409289-34409311 CTCTGCTTTCAGAAGGAGCAAGG + Intergenic
990711322 5:58583287-58583309 AACTGCTTGTGCGCGGAGCAAGG - Intronic
991098997 5:62770961-62770983 TACAGGTTGTACAAGGAGCATGG - Intergenic
991391283 5:66145679-66145701 AAATGCTCGTAAAAGGAACATGG - Intronic
992073346 5:73168952-73168974 AGCTGCCTGCAGAAGCAGCATGG + Intergenic
993944032 5:94097006-94097028 AGCTGCTTGGAGAAGTGGCAGGG + Intronic
994732200 5:103505459-103505481 AACTGTTTATGGAATGAGCAGGG - Intergenic
995167160 5:109057570-109057592 GACTGCTTGTGCCAGGAGCAAGG - Intronic
997621278 5:135297757-135297779 AACAGCTTTAAGAAAGAGCATGG - Intronic
999431110 5:151526068-151526090 GACTGCTTGTAGATGGTGCCTGG + Intronic
1000868907 5:166550551-166550573 AAATGTTTGTAGAATGAGTAAGG - Intergenic
1002055879 5:176597655-176597677 AACTGCCTGGAGGAGGAGGACGG + Exonic
1002208885 5:177583931-177583953 AACTGCTTATTGAAAGAGCCTGG + Intergenic
1005137034 6:22581024-22581046 GACTGCATGTATAATGAGCAGGG - Intergenic
1008647645 6:53531429-53531451 ACCTGCTTGCTGAAGGACCATGG - Intronic
1009408996 6:63343804-63343826 AACTGCTTTTAAAAGGCTCATGG - Intergenic
1011301784 6:85882934-85882956 AAATGATTCAAGAAGGAGCAAGG - Intergenic
1011311123 6:85980924-85980946 ACCTGCTTGTACATGGAGCAGGG + Intergenic
1011680880 6:89782298-89782320 AAAAGCATGTAAAAGGAGCAGGG + Intronic
1013235600 6:108195412-108195434 CGCTGCATGTGGAAGGAGCATGG - Intergenic
1015077617 6:129180156-129180178 AACTGATTGTAAAAACAGCATGG + Intronic
1015934233 6:138392230-138392252 AATTGCTTGTGGTAGGACCAGGG + Intergenic
1016328582 6:142931674-142931696 AACTGCATTTATAAGTAGCAAGG - Intronic
1016459412 6:144266353-144266375 AACTGTTTTTAGAAGCCGCAGGG + Intergenic
1018695311 6:166386373-166386395 GTCTGCTTGTAGAAGGGGCTGGG + Intergenic
1018931445 6:168242713-168242735 ACCTGCTTGTTGAAGAAACATGG - Intergenic
1021419979 7:20435533-20435555 AAATGCTTTTACAAGGAGCTTGG + Intergenic
1023521316 7:41052799-41052821 AACTCCTTGCAGTAGGTGCATGG + Intergenic
1024287730 7:47773757-47773779 AGCTGCCTGTAAAAGGGGCATGG + Intronic
1024904570 7:54362031-54362053 AGGTGCTCTTAGAAGGAGCAAGG - Intergenic
1024935693 7:54709814-54709836 AACTGCTTGTGAGTGGAGCATGG + Intergenic
1024996141 7:55274380-55274402 GACTGCTTGAGGAAGGAGCGAGG - Intergenic
1027554679 7:79648462-79648484 AGCTGCTTGGAGAAGTGGCAGGG - Intergenic
1027947264 7:84764319-84764341 AACTGTTTTTAGAATGAGAATGG - Intergenic
1028275476 7:88851187-88851209 AAGTGCCTGAAGAAGGAGTAGGG + Intronic
1030752070 7:113240912-113240934 AAATGCTTTTAGAAGCAGCCAGG - Intergenic
1031395484 7:121268761-121268783 AACTCCAAGTAGAAGCAGCAGGG - Intronic
1035607326 8:938568-938590 AACTGCTTCTGCAGGGAGCAGGG - Intergenic
1036167884 8:6454457-6454479 AACTGTTTGAAGGAGGAGGAAGG + Intronic
1037328198 8:17716357-17716379 AACTCCTTGCTGTAGGAGCAAGG - Intronic
1039672036 8:39612484-39612506 AGCTGCTTGGAGAAGTGGCAGGG + Intronic
1040063080 8:43121216-43121238 CACTGCTTGCAGAATGAGCCTGG + Intronic
1040834945 8:51722071-51722093 AACTGCTTGCGGAAGGAAGAAGG - Intronic
1042002762 8:64144913-64144935 AACTGCTGCTAGTAGGAGCAGGG - Intergenic
1042842113 8:73134353-73134375 AACTGAATGGAGAAAGAGCAGGG + Intergenic
1044379397 8:91516330-91516352 AACTGGTGGTAGCAGGTGCAGGG - Intergenic
1045823937 8:106374180-106374202 CACTGCCTATATAAGGAGCATGG + Intronic
1046853365 8:119001036-119001058 AAAAGGTTGGAGAAGGAGCAGGG - Intronic
1048229276 8:132621079-132621101 GACTGCGGGAAGAAGGAGCAGGG + Intronic
1048817265 8:138345405-138345427 GAGTGCTTGTAGCAGCAGCAGGG + Intronic
1053021648 9:34698951-34698973 AACTGTTAGCAGAAGAAGCATGG - Intergenic
1054936714 9:70696078-70696100 ATCAGCTTGAAGAAGGGGCAAGG + Intronic
1054936949 9:70698243-70698265 ATCGGCTTGAAGAAGGGGCAAGG - Intronic
1055807662 9:80114923-80114945 AACTGCCTGTAGAATGTGGATGG - Intergenic
1059985921 9:119820475-119820497 AACTGTTTCTAGAAGGGTCAGGG + Intergenic
1188190355 X:27164959-27164981 GACAGGTTGTACAAGGAGCATGG - Intergenic
1188820432 X:34768209-34768231 GACTGCTAGTAGAAGTAGAATGG + Intergenic
1189095789 X:38137836-38137858 CACAGCTTGGAGAAGGAGCTAGG - Intronic
1190523064 X:51299455-51299477 AACTGCATGTAGAAAGGGGAGGG + Intergenic
1192872282 X:75195535-75195557 AACTGCTTAGAGAAGTGGCAGGG - Intergenic
1193301292 X:79891905-79891927 ATCTGCTTAAAGAAGTAGCATGG - Intergenic
1193770274 X:85580028-85580050 AACTGGTTGTTTAAGGAGCCTGG - Intergenic
1197330734 X:125151437-125151459 AAATGCTTGTAAAAGGGGCTTGG + Intergenic
1197921373 X:131598058-131598080 AACTGGGTGTTGAAGGGGCAGGG + Intergenic
1198649257 X:138843153-138843175 CACTGCTGGTTGGAGGAGCAGGG - Intronic
1199772012 X:150981137-150981159 AACTGCTTGTAGAAGGAGCAGGG + Intronic
1199786727 X:151112650-151112672 AACTGCTTGGAGAAGTGGTAGGG - Intergenic