ID: 1199772287

View in Genome Browser
Species Human (GRCh38)
Location X:150982939-150982961
Sequence CTCCCACCGCACCGCGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 650
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 622}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199772287_1199772293 -3 Left 1199772287 X:150982939-150982961 CCAAGGCCGCGGTGCGGTGGGAG 0: 1
1: 0
2: 2
3: 25
4: 622
Right 1199772293 X:150982959-150982981 GAGCAGAGGGCAGCGCAGCGGGG 0: 1
1: 1
2: 0
3: 34
4: 388
1199772287_1199772294 1 Left 1199772287 X:150982939-150982961 CCAAGGCCGCGGTGCGGTGGGAG 0: 1
1: 0
2: 2
3: 25
4: 622
Right 1199772294 X:150982963-150982985 AGAGGGCAGCGCAGCGGGGCTGG 0: 1
1: 0
2: 3
3: 46
4: 442
1199772287_1199772292 -4 Left 1199772287 X:150982939-150982961 CCAAGGCCGCGGTGCGGTGGGAG 0: 1
1: 0
2: 2
3: 25
4: 622
Right 1199772292 X:150982958-150982980 GGAGCAGAGGGCAGCGCAGCGGG 0: 1
1: 0
2: 5
3: 58
4: 607
1199772287_1199772296 30 Left 1199772287 X:150982939-150982961 CCAAGGCCGCGGTGCGGTGGGAG 0: 1
1: 0
2: 2
3: 25
4: 622
Right 1199772296 X:150982992-150983014 TCTTCCCACGCCAGAGGCCGAGG 0: 1
1: 0
2: 0
3: 21
4: 164
1199772287_1199772291 -5 Left 1199772287 X:150982939-150982961 CCAAGGCCGCGGTGCGGTGGGAG 0: 1
1: 0
2: 2
3: 25
4: 622
Right 1199772291 X:150982957-150982979 GGGAGCAGAGGGCAGCGCAGCGG 0: 1
1: 0
2: 6
3: 115
4: 1133
1199772287_1199772295 24 Left 1199772287 X:150982939-150982961 CCAAGGCCGCGGTGCGGTGGGAG 0: 1
1: 0
2: 2
3: 25
4: 622
Right 1199772295 X:150982986-150983008 ACTTCATCTTCCCACGCCAGAGG 0: 1
1: 0
2: 1
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199772287 Original CRISPR CTCCCACCGCACCGCGGCCT TGG (reversed) Intronic
900191920 1:1355691-1355713 CTCCCAGCTCACCGCGGACTCGG + Exonic
901072612 1:6529543-6529565 CTGCCACCGCACTCCAGCCTGGG + Intronic
901336217 1:8451387-8451409 GTGCCACTGCACTGCGGCCTGGG + Intronic
901365672 1:8746020-8746042 CTGCCACTGCACTGCAGCCTGGG + Intronic
902059689 1:13631640-13631662 GTGCCACCGCACCCCAGCCTGGG + Intergenic
902323046 1:15682406-15682428 GTGCCACCGCACTCCGGCCTGGG + Intergenic
902449497 1:16487709-16487731 CTGCCACTGCACTGCAGCCTGGG + Intergenic
903350087 1:22711713-22711735 CGGCCACCGCCCCGCGGCCGCGG + Intronic
903514779 1:23902974-23902996 CTCGCGCCGCGCCGGGGCCTCGG + Intronic
904551950 1:31325948-31325970 GTGCCACCGCACCCCAGCCTGGG + Intronic
904779550 1:32935179-32935201 CACCCACTGCACTGCAGCCTGGG - Intergenic
905223377 1:36464187-36464209 CTCCCACCGCCCGGCAGCCCGGG + Exonic
905567514 1:38977605-38977627 GTCCCACCACACCGGGCCCTGGG + Intergenic
905864174 1:41367683-41367705 CTGCCACTGCACCCCAGCCTGGG - Intronic
906659176 1:47570532-47570554 CTACCACATCACCACGGCCTGGG - Intergenic
906764755 1:48418677-48418699 CTGCCACCGCACTCCAGCCTGGG + Intronic
907051076 1:51330335-51330357 CTCCCCCCGCGCACCGGCCTGGG - Intronic
908580485 1:65510968-65510990 CTCCCACTGCACCCCACCCTGGG + Intronic
910225507 1:84931979-84932001 CTGCCACTGCACTGCAGCCTGGG + Intronic
910775716 1:90872736-90872758 CTCCCACTGCACTCCAGCCTGGG - Intergenic
910813046 1:91257394-91257416 ATCCCACTGCACCCCAGCCTGGG + Intergenic
912514913 1:110211322-110211344 CTCCTCCCGCTCCGCGTCCTAGG + Intronic
914757370 1:150571381-150571403 GTCCCACTGCACTGCAGCCTGGG + Intergenic
914856444 1:151355045-151355067 CTGCCACCGCACTCCAGCCTGGG - Intergenic
914880696 1:151544337-151544359 GTGCCACCGCACCCCAGCCTGGG - Intronic
915468492 1:156112341-156112363 CTGCCACCGCACTCCAGCCTGGG + Intronic
915549777 1:156625280-156625302 AGCCCCCCGCAGCGCGGCCTCGG - Exonic
918015990 1:180632535-180632557 CTCCCACCGTTCCCCGGCCCCGG - Intronic
918512839 1:185330099-185330121 CTGCCACTGCACCCCAGCCTGGG - Intergenic
918796253 1:188900662-188900684 ATGCCACCGCACTGCAGCCTGGG + Intergenic
918981844 1:191571417-191571439 CTCCCACTGCACTCCAGCCTGGG + Intergenic
919035296 1:192299854-192299876 ATCCCACCGCACTTCAGCCTAGG - Intergenic
919128479 1:193425512-193425534 GTGCCACTGCACCGCAGCCTGGG + Intergenic
919583681 1:199409165-199409187 CTCCCACTGCACTCCAGCCTGGG - Intergenic
919640107 1:200038804-200038826 CTCCCACCCCACCCTGGCCCGGG - Intronic
920021132 1:202957802-202957824 CTCCCCACGCGCGGCGGCCTCGG + Intronic
920247342 1:204598292-204598314 GAGCCACCGCACCCCGGCCTGGG + Intergenic
921382265 1:214536154-214536176 CCCCCACCCCACCCCGGCCTTGG - Intronic
922723427 1:227910448-227910470 CTCCCACCGCAATGATGCCTGGG - Intergenic
922787063 1:228288115-228288137 CTCACACCGCAGCGTGGCCGTGG - Exonic
923184722 1:231560020-231560042 ATGCCACTGCACTGCGGCCTAGG - Intronic
923338235 1:232987763-232987785 ACCCCACCCCACCGTGGCCTAGG + Intronic
924471157 1:244343766-244343788 CTGCCACTGCACTCCGGCCTGGG + Intergenic
924542288 1:244992695-244992717 GTGCCACTGCACCGCAGCCTGGG + Intronic
924732446 1:246724383-246724405 CTCCACCCGCCCCGGGGCCTGGG + Exonic
1063078347 10:2739397-2739419 CTGCCACCGCACTGCAGCCTGGG - Intergenic
1063340856 10:5262007-5262029 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1063435374 10:6025309-6025331 GTACCACCGCACCCCAGCCTGGG + Intronic
1063451110 10:6150955-6150977 CTGCCACTGCACCCTGGCCTGGG + Intronic
1064763531 10:18646786-18646808 GTGCCACCGCACTGCAGCCTGGG + Intronic
1064854793 10:19754151-19754173 ATGCCACCGCACTTCGGCCTGGG - Intronic
1065101112 10:22334456-22334478 CTCCCGGTGCCCCGCGGCCTTGG - Intergenic
1065476108 10:26139656-26139678 CCCCCACCGCACCCCAACCTTGG - Intronic
1065616925 10:27536493-27536515 CTCCCACTGCACTCCAGCCTAGG + Intronic
1066369130 10:34805312-34805334 CTGCCACTGCACTGCAGCCTGGG + Intronic
1067880928 10:50044179-50044201 ATGCCACCGCACCCCAGCCTGGG + Intergenic
1068549333 10:58387885-58387907 GTACCACCGCACTGCAGCCTGGG + Intronic
1069251267 10:66270254-66270276 CTGCCACTGCACTGCAGCCTGGG - Intronic
1070076163 10:73138607-73138629 GTGCCACTGCACCGCAGCCTGGG - Intronic
1070238780 10:74656900-74656922 GTGCCACCGCACCCCAGCCTAGG - Intronic
1070767962 10:79067335-79067357 CTCCCCCCGCAGCCCGGCCGGGG + Intergenic
1072078896 10:92008384-92008406 CTGCCACTGCACCCCAGCCTGGG - Intronic
1072656702 10:97334780-97334802 CTACCACCGCACCGGGGCGGGGG + Intergenic
1073165219 10:101441837-101441859 CACCCACTGCACTGCAGCCTGGG + Intronic
1073209571 10:101788394-101788416 CTGCCACCGCACTCCAGCCTGGG + Intronic
1074076657 10:110132880-110132902 CTGCCACTGCACTCCGGCCTGGG + Intronic
1074505614 10:114067763-114067785 CTTCCACTGCACTGCAGCCTAGG - Intergenic
1074801824 10:117007510-117007532 CTGCCACTGCACTGCAGCCTGGG + Intronic
1074847106 10:117407930-117407952 CTGCCACTGCACTGCAGCCTGGG + Intergenic
1075271989 10:121060266-121060288 ATGCCACTGCACCGCAGCCTGGG + Intergenic
1075774570 10:124973193-124973215 CTGCCACCGCACTCCAGCCTAGG - Intronic
1076226692 10:128782292-128782314 ATGCCACCGCACCCCAGCCTGGG - Intergenic
1077008557 11:370077-370099 CTCCCACCGCACAGAGGTCTCGG + Intronic
1077143520 11:1035105-1035127 CTCCCGGCCCACCGCGGCCCAGG + Intronic
1077194409 11:1272190-1272212 CTCCCAGCGGAAGGCGGCCTGGG - Intergenic
1077278937 11:1733276-1733298 CTCCCATCCCACCACTGCCTGGG + Exonic
1077290942 11:1792393-1792415 CTGCCACCGCACTCCAGCCTGGG + Intergenic
1077322316 11:1947806-1947828 CCCCCACCGCAGCGCGGGCGCGG + Intronic
1077618986 11:3702193-3702215 GTGCCACCGCACCCCAGCCTGGG + Intronic
1078135599 11:8649294-8649316 ATGCCACCGCACCCCAGCCTGGG + Intronic
1078272129 11:9805663-9805685 CCCCCACTGCACTGCAGCCTGGG - Intronic
1079110397 11:17602117-17602139 CTCCCACCCCACTGCTGCCAAGG + Intronic
1079418816 11:20266479-20266501 CTGCCACCGCACTCCAGCCTGGG + Intergenic
1079642458 11:22823770-22823792 TTCCCACCTCACCCCAGCCTGGG - Intronic
1079710946 11:23680907-23680929 CTCCCACCTCACCGAGGGCAGGG - Intergenic
1080581286 11:33645969-33645991 CACCCACTGCACCCCGGCCCTGG - Exonic
1082020309 11:47527346-47527368 GTGCCACCGCACTCCGGCCTGGG + Intronic
1082038451 11:47664922-47664944 CTACCACTGCACCCCAGCCTGGG - Intronic
1082801586 11:57418845-57418867 CTGCCACCGCACTCCAGCCTGGG + Intronic
1082845420 11:57721256-57721278 GTGCCACCGCACCCCAGCCTAGG + Intronic
1083851946 11:65373192-65373214 GTGCCACCGCACCCCAGCCTGGG + Intergenic
1083902006 11:65647668-65647690 CTCCCACCTCCCCGCGTCCCCGG - Intronic
1083922303 11:65787480-65787502 CTCCAACCGCCCTCCGGCCTGGG + Intronic
1084305858 11:68282954-68282976 CTCCCACCGCACCTGCTCCTGGG + Intergenic
1085132311 11:74051250-74051272 CTACCACTGCACTCCGGCCTGGG + Intronic
1085150324 11:74247528-74247550 GTCCCACCGCACTCCAGCCTGGG - Intronic
1086458993 11:86986724-86986746 CTGCCACCGCACTCCAGCCTGGG - Intergenic
1089080215 11:115769837-115769859 ATCCCTCTGCACCGAGGCCTTGG + Intergenic
1089532634 11:119140907-119140929 GTGCCACTGCACCCCGGCCTGGG - Intergenic
1090377147 11:126298660-126298682 ATCCCACTGCACTCCGGCCTGGG - Intronic
1090788638 11:130070509-130070531 CTCGCGCGGCACCGGGGCCTCGG + Intronic
1090818559 11:130319521-130319543 CGCCCACCGCACTCCAGCCTGGG - Intergenic
1202805334 11_KI270721v1_random:3119-3141 CCCCCACCGCAGCGCGGGCGCGG + Intergenic
1091864178 12:3816857-3816879 GTGCCACCGCACTGCAGCCTGGG + Intronic
1091894685 12:4091715-4091737 CTGCCACCGCACTCCAGCCTGGG + Intergenic
1092354360 12:7782334-7782356 GTCCCACCGCACTCCAGCCTGGG + Intergenic
1092522423 12:9288558-9288580 GTCCCACTGCACTCCGGCCTGGG - Intergenic
1092544861 12:9443343-9443365 GTCCCACTGCACTCCGGCCTGGG + Intergenic
1092854360 12:12658598-12658620 GTGCCACTGCACCGCAGCCTGGG + Intergenic
1092918415 12:13208892-13208914 CTCCCACGGCACCTCTACCTGGG - Intronic
1093733559 12:22593096-22593118 CCCCCACTGCACTCCGGCCTGGG - Intergenic
1094603201 12:31928719-31928741 CTGCCACCGCACTCCAGCCTGGG - Intergenic
1095441579 12:42243276-42243298 GTGCCACCGCACTGCAGCCTGGG + Intronic
1096048018 12:48581462-48581484 GTGCCACCGCACCCCAGCCTGGG - Intergenic
1096972728 12:55681024-55681046 CTGCCACTGCACCCCAGCCTGGG + Intergenic
1097387911 12:58972720-58972742 CTCCCACTGCACTCCAGCCTGGG - Intergenic
1097794832 12:63850472-63850494 CACCCACTGCACTGCAGCCTGGG - Intronic
1100315249 12:93439434-93439456 CTGCCACTGCACTGCAGCCTGGG + Intronic
1101592878 12:106139122-106139144 CTCCCAGCTCACGGCGGCCCCGG - Exonic
1101910512 12:108857493-108857515 CTCGCACCGCGCCGCAGCCATGG - Exonic
1102059520 12:109922241-109922263 CTCCCGCCGCACCACTGCCAGGG + Intronic
1102059774 12:109923648-109923670 CTCCCACCACACCCCTGCCAGGG + Intronic
1102152377 12:110697691-110697713 GTGCCACCGCACTGCAGCCTGGG - Intronic
1102291113 12:111700799-111700821 GTGCCACCGCACTGCAGCCTAGG - Intronic
1102371062 12:112382479-112382501 CGCCCACCGCTCCGCGGACGAGG + Intergenic
1102387744 12:112524588-112524610 CTCCCACTGCACTCCAGCCTGGG - Intergenic
1102674875 12:114650630-114650652 GTGCCACCACACTGCGGCCTGGG - Intergenic
1103548578 12:121719541-121719563 CTGCCACTGCACCCCAGCCTGGG + Intronic
1103549981 12:121729754-121729776 GTGCCACTGCACCGCAGCCTGGG + Intronic
1103595980 12:122024364-122024386 CTCCGAGAGCACCGCGCCCTGGG + Intronic
1103782923 12:123411437-123411459 CTGCCACTGCACTCCGGCCTGGG + Exonic
1104575985 12:129966304-129966326 CTCCCACCCTACAGCGGCCCTGG + Intergenic
1105059980 12:133140333-133140355 ATGCCACCGCACTCCGGCCTAGG + Intronic
1105351580 13:19620813-19620835 CTGCCACTGCACTGCAGCCTGGG + Intergenic
1105508485 13:21031811-21031833 CACCCACTGCACTCCGGCCTGGG + Intronic
1106089017 13:26570243-26570265 CTGCCACTGCACTGCAGCCTGGG + Intronic
1107031920 13:35861988-35862010 CGCCCACCGCACTCCAGCCTGGG + Intronic
1108249159 13:48547794-48547816 CTCCCACTGCACTCCAGCCTGGG + Intergenic
1110856383 13:80301580-80301602 CCGCCACGGCACTGCGGCCTGGG - Intergenic
1110921934 13:81099480-81099502 CTCCCACTGCACTCCAGCCTGGG - Intergenic
1111503304 13:89154057-89154079 CTGCCACCGCACCCCAGCCTGGG + Intergenic
1111775562 13:92656925-92656947 CTCACACCGCACTCCAGCCTGGG + Intronic
1113154214 13:107299391-107299413 CTGCCACCGCACTCCAGCCTGGG + Intronic
1113533458 13:111045921-111045943 CTCCCAGGGCCCCGTGGCCTTGG + Intergenic
1114305918 14:21422884-21422906 GTGCCACCGCACCCCAGCCTGGG + Intronic
1114738255 14:25065453-25065475 CTGCCACCGCACTCCAGCCTGGG - Intergenic
1115114197 14:29859563-29859585 CTGCCACTGCACCTCAGCCTGGG + Intronic
1115173478 14:30534852-30534874 GTACCACCGCACCCCAGCCTGGG - Intergenic
1115242866 14:31266921-31266943 GTGCCACCGCACTGCAGCCTGGG - Intergenic
1115500534 14:34045734-34045756 CCGCCACCGCACTGCAGCCTGGG - Intronic
1116253261 14:42515736-42515758 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1116434516 14:44881645-44881667 CTGCCACTGCACCCCAGCCTGGG - Intergenic
1117486714 14:56204985-56205007 ATGCCACTGCACCGCAGCCTGGG + Intronic
1117678842 14:58182354-58182376 GTCCCACTGCACCCCAGCCTGGG + Intronic
1118345968 14:64941107-64941129 GTGCCACCGCACCCCAGCCTAGG - Intronic
1118834427 14:69466744-69466766 CTACCACTGCACCCCAGCCTGGG - Intergenic
1118859608 14:69652408-69652430 CTCCCACTGCACTCCAGCCTGGG + Intronic
1119163029 14:72469245-72469267 CTGCCACTGCACTGCAGCCTGGG - Intronic
1119333720 14:73814967-73814989 CTGCCACCGCACTCCAGCCTGGG + Intergenic
1119399428 14:74352220-74352242 CGCCCACCGCACTCCAGCCTGGG - Intronic
1119520004 14:75278434-75278456 CTCCCCCCGCACTGCACCCTCGG + Intergenic
1119795016 14:77388453-77388475 ATGCCACTGCACTGCGGCCTAGG - Intronic
1120801489 14:88693812-88693834 CTCCCACTGCACTGCAGCCTGGG - Intronic
1120822338 14:88923859-88923881 GTGCCACCGCACTGCAGCCTGGG - Intergenic
1120840484 14:89080983-89081005 CACCCACCGCACTCCAGCCTGGG + Intergenic
1121229407 14:92345657-92345679 GTGCCACTGCACTGCGGCCTGGG + Intronic
1121575963 14:94988134-94988156 ATACCACCGCACTGCAGCCTGGG - Intergenic
1122544974 14:102517155-102517177 CTCCCCTCGCCCCGCGGCCTCGG + Intergenic
1122688744 14:103521853-103521875 CTCCCCCCGCACTGCAGCCGCGG - Exonic
1122912005 14:104834762-104834784 GTGCCACTGCACCGTGGCCTGGG + Intergenic
1122993246 14:105248790-105248812 CTCGCGCCGCGCCGGGGCCTCGG - Exonic
1123870520 15:24567139-24567161 CTGCCACTGCACTGCAGCCTGGG + Intergenic
1124015887 15:25875367-25875389 ATACCACCGCACCCTGGCCTGGG - Intergenic
1124577241 15:30920825-30920847 CTGCCACTGCACCCCAGCCTAGG - Intronic
1125522788 15:40357502-40357524 CCCCCACCCCACCTCAGCCTGGG - Intergenic
1125720861 15:41844575-41844597 CTCCTACATCACCGGGGCCTCGG + Exonic
1127321134 15:57847403-57847425 GTGCCACTGCACCGCAGCCTGGG + Intergenic
1127400451 15:58580194-58580216 GTGCCACCGCACTGCAGCCTGGG - Intergenic
1127481088 15:59377745-59377767 CTGCCACCGCACTCCAGCCTGGG + Intronic
1127539452 15:59922476-59922498 ATCCTACCTCACTGCGGCCTTGG + Intergenic
1127873018 15:63088990-63089012 GTGCCACTGCACTGCGGCCTGGG - Intergenic
1127913042 15:63434186-63434208 CTGCCACTGCACTCCGGCCTGGG + Intergenic
1128076263 15:64827902-64827924 CTGCCACTGCACTCCGGCCTGGG - Intergenic
1129376217 15:75133923-75133945 GTGCCACTGCACCCCGGCCTGGG + Intergenic
1130655246 15:85788011-85788033 GCGCCACCGCACTGCGGCCTGGG + Intronic
1130987401 15:88853593-88853615 GTGCCACCGCACTGCAGCCTGGG + Intronic
1130997615 15:88912620-88912642 CTCCCTCCCTCCCGCGGCCTTGG - Intronic
1131134331 15:89921888-89921910 ATGCCACCGCACTGCAGCCTGGG - Intergenic
1131245782 15:90791679-90791701 CTGCCACTGCACTGCAGCCTGGG - Intronic
1131284007 15:91042767-91042789 ATGCCACCGCACTGCAGCCTGGG + Intergenic
1132549685 16:549214-549236 CACCCGCCCCACCCCGGCCTTGG - Intronic
1132869401 16:2109056-2109078 CTCCAACAGCCCCGCGGCCACGG + Exonic
1132983107 16:2749323-2749345 CTCCCACCTCCCAGCTGCCTGGG - Intergenic
1133300722 16:4780934-4780956 CTGCCACTGCACCCCAGCCTGGG + Intronic
1133566167 16:6995716-6995738 ATGCCACCGCACTGCAGCCTGGG + Intronic
1133959893 16:10484338-10484360 CTGCCACTGCACTCCGGCCTGGG - Intergenic
1134360128 16:13523305-13523327 CTGCCACTGCACTGCAGCCTGGG + Intergenic
1134475276 16:14568253-14568275 GTGCCACTGCACCGCAGCCTGGG - Intronic
1134512333 16:14858669-14858691 CTCACACCCCACCGGGGCGTAGG + Intronic
1134621033 16:15689447-15689469 GTGCCACCGCACCCCAGCCTGGG + Intronic
1134642752 16:15842345-15842367 CTCTCACCGCACTCCAGCCTGGG + Intronic
1134718010 16:16366542-16366564 CTCCAACAGCCCCGCGGCCACGG - Intergenic
1134956741 16:18385617-18385639 CTCCAACAGCCCCGCGGCCACGG + Intergenic
1135333382 16:21580475-21580497 ATCCCACTGCACCCCGGCCTGGG + Intergenic
1135407700 16:22209833-22209855 GTGCCACTGCACCGCAGCCTGGG - Intronic
1135533089 16:23271471-23271493 CTGCCACTGCACCCCAGCCTGGG - Intergenic
1135548901 16:23383554-23383576 GTGCCACTGCACCGCAGCCTGGG - Intergenic
1135607259 16:23835740-23835762 CCCCCACCCCACCCCGTCCTCGG - Intergenic
1135671915 16:24382612-24382634 GTCCCACTGCACTGCAGCCTGGG + Intergenic
1135924856 16:26684692-26684714 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1136609426 16:31357150-31357172 CTCCCAGCCCCCCGCGGCCCCGG - Intronic
1136617222 16:31405683-31405705 GTGCCACCGCACCCCAGCCTGGG - Intronic
1137775083 16:51047695-51047717 CTCCCATCACACCCCAGCCTAGG + Intergenic
1137835226 16:51585773-51585795 CTGCCACCGCACTCCAGCCTGGG - Intergenic
1138001723 16:53287682-53287704 GTGCCACCGCACTCCGGCCTGGG + Intronic
1138704388 16:58899245-58899267 CTCCCAGCTCACTGCAGCCTCGG - Intergenic
1138764637 16:59587453-59587475 CTGCCACTGCACCCCAGCCTGGG - Intergenic
1139074824 16:63431630-63431652 GTGCCACTGCACTGCGGCCTGGG - Intergenic
1139740317 16:69030063-69030085 ATGCCACCGCACCCCAGCCTGGG + Intronic
1139853800 16:69965485-69965507 TCCCCACCGCCCCCCGGCCTCGG - Intergenic
1139882778 16:70188398-70188420 TCCCCACCGCCCCCCGGCCTCGG - Intergenic
1140369732 16:74407121-74407143 TCCCCACCGCCCCCCGGCCTCGG + Intergenic
1140511663 16:75513070-75513092 CTGCCACTGCACTCCGGCCTGGG + Intergenic
1140722062 16:77780934-77780956 CTGCCACTGCACCACAGCCTGGG + Intergenic
1141127530 16:81411405-81411427 CTGCCACTGCACCCCAGCCTGGG - Intergenic
1141655998 16:85416896-85416918 GTGCCACTGCACCCCGGCCTGGG - Intergenic
1142581805 17:947688-947710 CTGCCACTGCACTCCGGCCTGGG + Intronic
1142658718 17:1412640-1412662 CTGCCACTGCACTGCAGCCTGGG + Intergenic
1142792437 17:2278003-2278025 ATGCCACCGCACCCCAGCCTGGG + Intronic
1142914358 17:3123676-3123698 ATGCCACCGCACCCCAGCCTGGG + Intergenic
1143059896 17:4191093-4191115 GTCCCACCGCACTCCAGCCTGGG + Intronic
1143845500 17:9770343-9770365 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1143882744 17:10042250-10042272 GTGCCACCGCACTCCGGCCTGGG + Intronic
1144067466 17:11637552-11637574 CTGCCACTGCACCCCAGCCTGGG + Intronic
1144140153 17:12340424-12340446 CTCCCACTGCACTCCAGCCTGGG - Intergenic
1146041269 17:29457140-29457162 ATGCCACCGCACTGCAGCCTGGG - Intronic
1146389085 17:32404696-32404718 GTGCCACTGCACTGCGGCCTGGG - Intergenic
1147665365 17:42143826-42143848 CTGCCACTGCACCCCAGCCTGGG - Intronic
1147736217 17:42640110-42640132 ATCCCACCACACTGCAGCCTGGG - Intergenic
1147758609 17:42783688-42783710 CTCCCACAGCACCTTGGCCGAGG + Intronic
1147925692 17:43944203-43944225 CTCCCACAGGACCATGGCCTTGG + Intergenic
1147964053 17:44184005-44184027 CTCCCACTGCACTCCAGCCTGGG + Intergenic
1148096097 17:45053298-45053320 CTGCCACTGCACCCCAGCCTGGG - Intronic
1149215942 17:54354445-54354467 CTCCCACTGCACTCCAGCCTAGG + Intergenic
1149816824 17:59733660-59733682 CTACCACTGCACCCCAGCCTGGG + Intronic
1149817892 17:59744417-59744439 CCACCACTGCACCCCGGCCTGGG + Intronic
1150183787 17:63157790-63157812 CTGCCACCGCACTCCAGCCTGGG - Intronic
1150822425 17:68446221-68446243 CTGCCACTGCACTGCAGCCTGGG - Intronic
1151440740 17:74127254-74127276 GTGCCACCGCACTGCAGCCTGGG - Intergenic
1151612144 17:75183083-75183105 GTCCCACGCCACCGCGTCCTGGG + Intergenic
1151680586 17:75620712-75620734 GTCCCACCGCATGGCAGCCTCGG - Intergenic
1151824050 17:76513714-76513736 ATCCCACTGCACTGCAGCCTGGG - Intergenic
1151940367 17:77288117-77288139 CTCCTACCCCACCCCGGCCTGGG + Intronic
1153097144 18:1419827-1419849 CTCCCACTGCACTCCAGCCTGGG + Intergenic
1153649563 18:7228135-7228157 GTCCCACCGCACTCCAGCCTGGG - Intergenic
1154349320 18:13569840-13569862 GTGCCACCGCACTGCAGCCTGGG + Intronic
1156089520 18:33449149-33449171 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1156347650 18:36272433-36272455 CTGCCACTGCACAGCGGCCTGGG + Intergenic
1157255123 18:46131868-46131890 CTGCCACTGCACTCCGGCCTGGG + Intergenic
1157460795 18:47891260-47891282 CCGCCACTGCACCGCAGCCTGGG + Intronic
1159005616 18:63007753-63007775 CTGCCACCGCACTCCAGCCTGGG - Intergenic
1159986443 18:74846949-74846971 CTGCCACTGCACTCCGGCCTGGG + Intronic
1159993910 18:74942957-74942979 GTCCCACTGCACTGCAGCCTGGG - Intronic
1160674260 19:380718-380740 CTGCCACTGCACTGCGGCCTGGG + Intergenic
1160710144 19:547643-547665 CTCCTTCCACACCGCAGCCTGGG + Intronic
1160713193 19:562860-562882 CGCCCACCGCACTCCAGCCTGGG - Intergenic
1160998527 19:1896676-1896698 CTCCCACTGCACTCCAGCCTGGG + Intergenic
1161195611 19:2984508-2984530 CTCCCACTGCACTCCAGCCTGGG - Intronic
1161333705 19:3700069-3700091 CTCCCACCGCTCCCGGGCCGGGG - Intronic
1161576741 19:5058562-5058584 CTCCCACCACACCCAGGCCCTGG - Intronic
1161717878 19:5886960-5886982 CTGCCACCGCACTCCAGCCTGGG - Intronic
1161828346 19:6584821-6584843 ATGCCACCGCACTGCAGCCTGGG + Intronic
1161870434 19:6865502-6865524 GTCCCACTGCACCCCAGCCTGGG + Intergenic
1162129354 19:8516150-8516172 ATGCCACTGCACTGCGGCCTGGG - Intergenic
1162276221 19:9657349-9657371 CTGCCACTGCACCCCAGCCTGGG + Intronic
1162567393 19:11451789-11451811 CCCCCCCCCCACCGAGGCCTAGG - Exonic
1162782636 19:13014435-13014457 CTCCCACCAGCCCGCCGCCTGGG - Intronic
1163001131 19:14368055-14368077 GTGCCACTGCACTGCGGCCTGGG + Intergenic
1163099399 19:15084939-15084961 GTGCCACCGCACTGCAGCCTGGG + Intergenic
1163342609 19:16719176-16719198 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1163345651 19:16740376-16740398 TTCCCACTGCACCCCAGCCTGGG - Intronic
1163543829 19:17928850-17928872 GTGCCACTGCACCGCAGCCTGGG - Intergenic
1163881623 19:19928565-19928587 CTGCCACTGCACTGCAGCCTGGG - Intronic
1163974142 19:20832591-20832613 ATGCCACTGCACCGCAGCCTGGG + Intronic
1164228349 19:23265841-23265863 GTGCCACCGCACTGCAGCCTGGG + Intergenic
1164476922 19:28582586-28582608 CTGCCACCGCACTCCAGCCTGGG + Intergenic
1165135258 19:33663825-33663847 CTGCCACCGCACTCCAGCCTGGG + Intronic
1165162743 19:33827365-33827387 CTACCACTGCACCCCAGCCTGGG - Intergenic
1165416307 19:35695866-35695888 CTGCCACTGCACTGCAGCCTGGG + Intergenic
1165893472 19:39128282-39128304 CTGCCACCCCACCACTGCCTGGG + Intronic
1165954900 19:39496407-39496429 ATGCCACTGCACCGCAGCCTGGG + Intergenic
1166049687 19:40250783-40250805 CTGCCACTGCACTGCAGCCTGGG + Intronic
1166656622 19:44616939-44616961 CTGCCACTGCACTGCAGCCTGGG - Intronic
1166726412 19:45030752-45030774 GTGCCACCGCACTGCAGCCTGGG + Intronic
1167260889 19:48457036-48457058 CTACCACTGCACTGCAGCCTGGG - Intronic
1167864097 19:52310096-52310118 CTGCCACGGCACCCCAGCCTGGG - Intronic
1168000410 19:53441237-53441259 CTGCCACTGCACTGCAGCCTGGG + Intronic
1168038524 19:53739530-53739552 CTGCCACCGCACTCCAGCCTGGG - Intergenic
1168050099 19:53823589-53823611 CTGCCACTGCACCCCAGCCTAGG - Intronic
1168153747 19:54462239-54462261 CCCCCACCTCACCGTGGCCAAGG - Exonic
1168155207 19:54470327-54470349 GTCCCACCGCACTTCAGCCTGGG + Intronic
1168258420 19:55179633-55179655 CTCCCTCCGCACCTGGTCCTGGG + Intronic
1168708238 19:58481834-58481856 GTGCCACCGCACTGCAGCCTGGG - Intronic
925294140 2:2766691-2766713 CACCCACCGCACGGCAGCCCTGG + Intergenic
926090303 2:10044686-10044708 CGCCCACTGCACTCCGGCCTGGG - Intronic
927170041 2:20361803-20361825 GTGCCACCGCACTCCGGCCTGGG + Intergenic
927214968 2:20663203-20663225 CTGCCACTGCACTGCAGCCTGGG + Intergenic
927417657 2:22895460-22895482 GTGCCACTGCACCGCAGCCTGGG + Intergenic
927755280 2:25703394-25703416 CTGCCACCGCACTCCAGCCTGGG + Intergenic
928140392 2:28723627-28723649 GTGCCACTGCACTGCGGCCTGGG + Intergenic
928340915 2:30442442-30442464 GTGCCACCGCACTGCAGCCTGGG - Intergenic
929156106 2:38789831-38789853 GTGCCACCGCACTGCAGCCTGGG + Intergenic
929210565 2:39352246-39352268 CTGCCACTGCACAGCAGCCTGGG + Intronic
929469734 2:42179643-42179665 ATGCCACCGCACCCCAGCCTGGG - Intronic
929856925 2:45645388-45645410 GTGCCACCGCACTGCAGCCTGGG + Intergenic
930635320 2:53798302-53798324 GTGCCACCGCACTCCGGCCTGGG - Intronic
930742566 2:54846960-54846982 CTGCCACCGCACTCCAGCCTGGG - Intronic
931598436 2:63976306-63976328 CTGCCACCGCACTCCAGCCTGGG + Intronic
931606924 2:64061836-64061858 CTCCCACTGCACCCCAGCCTGGG + Intergenic
933959916 2:87401491-87401513 GTCCCACCGCACTTCCGCCTGGG + Intergenic
934307603 2:91840140-91840162 CCCCCACTGCCCCGCTGCCTCGG + Intergenic
935645319 2:105329644-105329666 CCCGCGCCGCCCCGCGGCCTGGG + Exonic
935765898 2:106367352-106367374 CTGCCACTGCACCCCAGCCTGGG - Intergenic
935965189 2:108465895-108465917 GTGCCACTGCACCCCGGCCTGGG - Intronic
936942110 2:117895012-117895034 CTCCCACTGCACTCCAGCCTGGG - Intergenic
940528807 2:154852351-154852373 GTGCCACTGCACCGCAGCCTGGG + Intronic
941097340 2:161253659-161253681 GTCCCACTGCACTGCAGCCTGGG - Intergenic
941365685 2:164608326-164608348 CACCCACTGCACCCCAGCCTGGG + Intronic
941491107 2:166143207-166143229 CTGCCACCGCACTCCAGCCTGGG - Intergenic
941888142 2:170550939-170550961 ATGCCACCGCACTGCAGCCTGGG - Intronic
941948659 2:171129790-171129812 CTGCCACCGCACTCCAGCCTGGG + Intronic
942527347 2:176868602-176868624 ATGCCACCGCACTGCAGCCTGGG - Intergenic
942747087 2:179246210-179246232 ATGCCACTGCACTGCGGCCTGGG + Intronic
944606691 2:201358267-201358289 CTGCCACTGCACCGCAGCCTGGG - Intergenic
944703838 2:202269030-202269052 CTGCCACTGCACCCCAGCCTGGG - Intronic
944715978 2:202376441-202376463 CTCCCGCCGCCCCCCGCCCTCGG + Intergenic
944740177 2:202604301-202604323 ATGCCACTGCACCGCAGCCTGGG + Intergenic
945251723 2:207770023-207770045 CGCCCACTGCCCCGCGGGCTCGG + Intergenic
946248550 2:218400181-218400203 CTCCCACGGCGCCCCGGCTTCGG - Intronic
946311271 2:218883738-218883760 CTCCCGCCCCACCGCCGCCCGGG + Intronic
946692558 2:222320108-222320130 CTCCCCCTGCACCGCCGCCTGGG + Intergenic
947384270 2:229575634-229575656 CTCCAACACCACCGCAGCCTGGG + Intronic
947725698 2:232398625-232398647 CTGCCACCGCACTCCAGCCTGGG - Intergenic
948468780 2:238164455-238164477 TTCACACCCCACCGTGGCCTAGG + Intronic
948807992 2:240461186-240461208 CACCCTCCCCACAGCGGCCTGGG + Intronic
949005205 2:241642206-241642228 CGCCCACCGCACTCCAGCCTGGG - Intronic
1169246485 20:4029223-4029245 ATGCCACCGCACCCCAGCCTGGG - Intergenic
1169255864 20:4098025-4098047 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1169453697 20:5733694-5733716 CTGCCACCGCACTCCAGCCTGGG + Intergenic
1171226675 20:23447509-23447531 GTGCCACTGCACTGCGGCCTGGG - Intergenic
1171896005 20:30761608-30761630 ATGCCACCGCACTGCAGCCTGGG + Intergenic
1171978328 20:31609428-31609450 GTGCCACCGCACCCCAGCCTGGG - Intergenic
1172109307 20:32536195-32536217 CTCCCGGGGCACCGCAGCCTAGG + Intronic
1172292294 20:33784656-33784678 CTGCCACCGCACTCCAGCCTGGG - Intronic
1172444502 20:34986022-34986044 CTCCCTCCGCATCGCCCCCTTGG + Intronic
1172718136 20:36979129-36979151 GCCCCACCGCACTGCAGCCTGGG - Intergenic
1172811705 20:37652781-37652803 ATGCCACCGCACCACAGCCTGGG - Intergenic
1173767285 20:45624147-45624169 GTCCCACCGCACTCCAGCCTAGG + Intronic
1173814882 20:45980831-45980853 CTGCCACTGCACCCCAGCCTGGG - Intergenic
1173930146 20:46811344-46811366 CGCCCTCCGCCCCGCCGCCTCGG + Intergenic
1174116524 20:48230191-48230213 CTCCTACCCCACAGTGGCCTGGG - Intergenic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1174349957 20:49959979-49960001 GTGCCACCGCACTGCAGCCTGGG + Intergenic
1174622100 20:51883358-51883380 CTGCCACTGCACTCCGGCCTGGG + Intergenic
1175715857 20:61253542-61253564 CCCCCAGCGCCCCGCGGCCTCGG - Intronic
1175889729 20:62310812-62310834 CTCCCAGCGCACGGAGACCTGGG + Exonic
1176030688 20:63009806-63009828 CTCCCACCGCGCCCTGGCCCTGG + Intergenic
1176551938 21:8227175-8227197 GCGCCACCGCACCGCAGCCTGGG - Intergenic
1176552332 21:8231639-8231661 GCGCCACCGCACCGCAGCCTGGG - Intergenic
1176570847 21:8410174-8410196 GCGCCACCGCACCGCAGCCTGGG - Intergenic
1176571237 21:8414231-8414253 GCGCCACCGCACCGCAGCCTGGG - Intergenic
1176578755 21:8454321-8454343 GCGCCACCGCACCGCAGCCTGGG - Intergenic
1176579151 21:8458793-8458815 GCGCCACCGCACCGCAGCCTGGG - Intergenic
1177277228 21:18927655-18927677 CTGCCACCGCACTGCAGCCTGGG + Intergenic
1178190988 21:30280914-30280936 GTGCCACTGCACCGCAGCCTGGG - Intergenic
1178252890 21:31021373-31021395 CTGCCACTGCACCCCAGCCTGGG - Intergenic
1178914468 21:36698992-36699014 CTCCGACCCCGCCGCGGCCCTGG - Intergenic
1179916852 21:44483258-44483280 CTGCCACCGCACTCCAGCCTGGG + Intergenic
1180355917 22:11839760-11839782 ATGCCACCGCACTGCAGCCTGGG - Intergenic
1180382339 22:12152566-12152588 ATGCCACCGCACTGCAGCCTGGG + Intergenic
1180688500 22:17689798-17689820 CTGCCACTGCACTGCAGCCTGGG + Intronic
1180910584 22:19447366-19447388 CTCCCGGCGCACCTGGGCCTCGG + Exonic
1180949420 22:19714500-19714522 CTCACCCCGCAGCCCGGCCTCGG + Exonic
1180966365 22:19789792-19789814 CTGCCACCGCACTCCTGCCTGGG + Intronic
1181634942 22:24170124-24170146 CCCCCACCGCACCAGGGTCTGGG - Intronic
1181647169 22:24238184-24238206 TTCCCACCACACCCCAGCCTGGG + Intronic
1182447765 22:30399469-30399491 CGCCCACCGCACTCCAGCCTGGG + Intronic
1182472948 22:30559890-30559912 CTCACACTGCACTGCGCCCTGGG + Intronic
1183433241 22:37778621-37778643 CTGCCACCGCACTCCAGCCTGGG + Intergenic
1183621981 22:38979595-38979617 GTCCCACTGCACTGCAGCCTGGG - Intronic
1184002019 22:41682113-41682135 CTACCACCTAACCTCGGCCTTGG + Intronic
1184068165 22:42131920-42131942 CTGCCACTGCACTCCGGCCTGGG - Intergenic
1184215598 22:43065100-43065122 CTGCCACCGCACTCCAGCCTGGG + Intronic
1184388798 22:44191268-44191290 CCCCCACCCCACCCCAGCCTCGG + Intronic
1184668898 22:46002638-46002660 GTGCCACCGCACTTCGGCCTGGG + Intergenic
1184679299 22:46061743-46061765 CTCCGACCCGACCCCGGCCTGGG + Intronic
1185213622 22:49586169-49586191 CACCCACTGCACAGAGGCCTGGG + Intronic
1185254339 22:49823978-49824000 CGCCCACGGCACGCCGGCCTCGG - Exonic
1185308549 22:50138745-50138767 CCGCCACTGCACCTCGGCCTGGG - Intronic
1185409318 22:50674145-50674167 CTCCCCCCGCACCGAGGCCTAGG + Intergenic
1185413431 22:50697578-50697600 CGCCCCCCGCACCGCCGCCCCGG + Intergenic
1203256958 22_KI270733v1_random:144102-144124 GCGCCACCGCACCGCAGCCTGGG - Intergenic
1203257330 22_KI270733v1_random:148422-148444 GCGCCACCGCACCGCAGCCTGGG - Intergenic
949526193 3:4906794-4906816 CACCCACTGCACTGCAGCCTGGG - Intergenic
950234105 3:11303623-11303645 CTGCCACTGCACTCCGGCCTGGG + Intronic
950273077 3:11634718-11634740 ATCCCACCGCACTCTGGCCTGGG - Intronic
951224534 3:20105756-20105778 CTACCACTGCACTCCGGCCTGGG + Intronic
951539048 3:23765099-23765121 ATCCCACCGCACTCCAGCCTAGG + Intergenic
952317132 3:32240828-32240850 GTGCCACCGCACCTCAGCCTGGG - Intronic
952334484 3:32392451-32392473 CTCCCTCAGCGCCGCCGCCTGGG - Intronic
952424905 3:33165966-33165988 GACCCACTGCACCGCAGCCTGGG + Intronic
952881006 3:37986414-37986436 CTCCCTCCTCACCCCTGCCTTGG - Intergenic
954774253 3:53001880-53001902 CTGCCACCGCATTCCGGCCTGGG + Intronic
955181416 3:56674464-56674486 CTCCCACCGCACTCCAGTCTGGG + Intronic
955382183 3:58448207-58448229 CTGCCACTGCACTCCGGCCTGGG + Intergenic
955408351 3:58639984-58640006 CCCCCACCGCACCTCTTCCTGGG + Intronic
955967015 3:64398985-64399007 ATGCCACTGCACCCCGGCCTGGG + Intronic
956163574 3:66379756-66379778 GTCCCACCGCACAGCAGCCTAGG + Exonic
956507304 3:69955769-69955791 CTGCCACCGCACTCCAGCCTGGG + Intronic
957491528 3:80933246-80933268 CTGCCACTGCACTGCAGCCTGGG + Intergenic
959244510 3:103847485-103847507 CTGCCACCGCACTCCAGCCTGGG - Intergenic
959917859 3:111837997-111838019 GTCCCACCGCACTCCAGCCTGGG + Intronic
960407847 3:117283879-117283901 GTGCCACTGCACCGCAGCCTGGG + Intergenic
960428737 3:117542863-117542885 ATGCCACCGCACTGCAGCCTGGG - Intergenic
960636335 3:119788478-119788500 GTCCCACTGCACTGCAGCCTGGG - Intronic
961234344 3:125351334-125351356 GTGCCACCGCACTCCGGCCTGGG + Intronic
961760656 3:129164956-129164978 CTCCCACAGCACTCCAGCCTTGG + Intergenic
963161029 3:142150353-142150375 CTGCCACCGCACTCCAGCCTCGG - Intergenic
964340795 3:155706575-155706597 CTGCCACTGCACTCCGGCCTGGG + Intronic
964800354 3:160550307-160550329 CTGCCACTGCACTGCAGCCTGGG - Intronic
965220630 3:165921785-165921807 CTGCCACCGCACTGCAGCCTGGG + Intergenic
965427548 3:168546285-168546307 ATGCCACCGCACCCCAGCCTGGG - Intergenic
965592483 3:170375614-170375636 CTGCCACTGCACTGCAGCCTAGG - Intronic
966017475 3:175159877-175159899 CTGCCACTGCACCCCAGCCTGGG - Intronic
966158386 3:176942960-176942982 GTGCCACCGCACTGCAGCCTGGG + Intergenic
966949654 3:184804628-184804650 GTGCCACTGCACCCCGGCCTGGG - Intergenic
968062214 3:195734163-195734185 CTACCACTGCACCCCAGCCTGGG + Intronic
968094531 3:195918995-195919017 CTGCCACTGCACCCCGGCCTGGG + Intergenic
968319013 3:197749529-197749551 CGCCCACCGCAACGCAGCCTCGG - Intronic
968531712 4:1095452-1095474 CTCCCACAGCTCCACGGTCTCGG + Intronic
968888383 4:3350637-3350659 GTCCCACTGCACCCCAGCCTGGG + Intronic
969418933 4:7078930-7078952 ATGCCACTGCACTGCGGCCTGGG - Intergenic
970025444 4:11619100-11619122 CTGCCACTGCACTGCAGCCTGGG + Intergenic
970333233 4:15004511-15004533 CTCCCAACCCACCGGGGGCTGGG - Intronic
970452984 4:16190379-16190401 GTCCCACTGCACCCCAGCCTGGG - Intronic
970614452 4:17754914-17754936 ATGCCACTGCACTGCGGCCTGGG - Intronic
970974490 4:22027807-22027829 ATGCCACCGCACTGCAGCCTGGG - Intergenic
972657886 4:41083120-41083142 ATCCCACCGCACTCCAGCCTGGG + Intronic
973372262 4:49260924-49260946 ATGCCACCGCACTGCAGCCTGGG + Intergenic
973388735 4:49534211-49534233 ATGCCACCGCACTGCAGCCTGGG - Intergenic
973910249 4:55572801-55572823 CACCCACTGCACTCCGGCCTGGG - Intronic
974234827 4:59167516-59167538 CTGCCACCGCACTCCAGCCTGGG + Intergenic
974765258 4:66336020-66336042 CTGCCACCGCACTCCAGCCTGGG + Intergenic
975132174 4:70840718-70840740 GTGCCACCGCACTGCAGCCTGGG + Intergenic
975409589 4:74034283-74034305 ATGCCACCGCACTGCAGCCTGGG - Intergenic
976088487 4:81430256-81430278 CTCCCACTGCACTCCAGCCTGGG + Intronic
976269504 4:83217105-83217127 CTCCCACTGCACCCAGGCCTTGG - Intergenic
977095875 4:92743232-92743254 CTGCCACTGCACTGCAGCCTGGG + Intronic
977286790 4:95117741-95117763 CTGCCACTGCACTGCAGCCTGGG + Intronic
977751472 4:100614615-100614637 CTCCCACTGCACTCCAGCCTGGG - Intronic
979101692 4:116624641-116624663 CTGCCACTGCACTCCGGCCTGGG + Intergenic
979540080 4:121870665-121870687 CTCCACCCTCACCGCGGCCCAGG + Intergenic
979658162 4:123221196-123221218 GTGCCACCGCACCCCAGCCTGGG - Intronic
979936117 4:126698643-126698665 CTGCCACCGCACTCCAGCCTGGG - Intergenic
979937229 4:126713229-126713251 GTGCCACTGCACCGCAGCCTGGG - Intergenic
980053213 4:128058194-128058216 CTGCCACCGCACTCCAGCCTGGG + Intergenic
980909339 4:138979623-138979645 CTGCCACCGCACTCCAGCCTGGG + Intergenic
981331152 4:143512131-143512153 ATGCCACCGCACTGCAGCCTGGG + Intergenic
981528149 4:145727837-145727859 ATGCCACTGCACCGCAGCCTGGG + Intronic
981972271 4:150678196-150678218 CTGCCACTGCACTCCGGCCTGGG + Intronic
985228889 4:187793896-187793918 CTGCCACTGCACTGCAGCCTGGG - Intergenic
985287506 4:188351525-188351547 CTGCCACTGCACCCCAGCCTGGG - Intergenic
985589626 5:757815-757837 CTCCCACCACACCCCGGCCTGGG - Intronic
985659509 5:1149532-1149554 GTGCCACTGCACTGCGGCCTGGG + Intergenic
986051782 5:4097000-4097022 GTGCCACTGCACCGCAGCCTGGG - Intergenic
986064435 5:4221991-4222013 CCACCACCGCACCCCAGCCTGGG + Intergenic
986897534 5:12388185-12388207 GTACCACCGCACTGCAGCCTGGG - Intergenic
987094395 5:14535244-14535266 CTGCCACCGCACTCCAGCCTGGG - Intergenic
988461938 5:31446995-31447017 ATGCCACTGCACCGCAGCCTGGG + Intronic
989380644 5:40806661-40806683 CACCCACTGCACTGCAGCCTGGG - Intergenic
990833392 5:59986092-59986114 CTGCCACTGCACCCTGGCCTGGG - Intronic
991358177 5:65791513-65791535 TTGCCACCGCACCCCAGCCTGGG + Intronic
991363532 5:65844890-65844912 CTCCCACTGCACTTCAGCCTGGG + Intronic
992714920 5:79501011-79501033 CTGCCACTGCACTGCAGCCTGGG - Intronic
992771774 5:80055277-80055299 GTCCCACTGCACTGCAGCCTGGG + Intronic
994957633 5:106553805-106553827 CTGCCACCGCACTCCAGCCTGGG + Intergenic
996498385 5:124188248-124188270 CTGCCACTGCACCCCAGCCTGGG - Intergenic
996525935 5:124479457-124479479 CTACCACTGCACTGCAGCCTGGG + Intergenic
997467502 5:134098235-134098257 GTGCCACTGCACTGCGGCCTGGG - Intergenic
997788230 5:136733444-136733466 CGCCCACCGCACTCCAGCCTGGG - Intergenic
998130912 5:139650612-139650634 CGCCCCCCACCCCGCGGCCTGGG - Intronic
998460925 5:142309465-142309487 GTGCCACCGCACTCCGGCCTGGG + Intergenic
999566617 5:152870312-152870334 ATGCCACTGCACTGCGGCCTGGG - Intergenic
999985333 5:156998964-156998986 CTGCCACTGCACTGCAGCCTGGG + Intergenic
1001567247 5:172707506-172707528 CACCCAGGGCACCGCGTCCTGGG + Intergenic
1002466485 5:179411356-179411378 CTGGCACCGCTCTGCGGCCTCGG + Intergenic
1002599546 5:180346465-180346487 CCCCCACCCCACCAGGGCCTCGG + Intronic
1002687974 5:181029408-181029430 CCCCCACTGCACTCCGGCCTGGG + Intergenic
1003000563 6:2328360-2328382 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1003028436 6:2579350-2579372 CTCCCACCGCCGCAGGGCCTGGG + Intergenic
1003285706 6:4732290-4732312 GTGCCACCGCACCCCAGCCTGGG + Intronic
1003349093 6:5298818-5298840 GTGCCACCGCACTGCAGCCTGGG + Intronic
1004404353 6:15318166-15318188 CTGCCACTGCACTGCAGCCTGGG + Intronic
1005019629 6:21405225-21405247 CTGCCACCGCACTCCAGCCTGGG - Intergenic
1005484534 6:26286931-26286953 CTCCCACCCCACCCCACCCTTGG - Intergenic
1005741741 6:28797480-28797502 CTGCCACCGCACTCTGGCCTGGG + Intergenic
1005745073 6:28829444-28829466 CTCCCATCGCACTCCAGCCTGGG - Intergenic
1006079112 6:31554368-31554390 ATGCCACCGCACTGCAGCCTGGG + Intronic
1006474137 6:34244327-34244349 CTTCCTCCCCACCCCGGCCTAGG + Intronic
1006946335 6:37786913-37786935 GTCCCACTGCACTGCAGCCTGGG + Intergenic
1006952489 6:37835200-37835222 CTGTCACCGCACCCCAGCCTGGG - Intronic
1007431480 6:41779811-41779833 CTCACATCGCCCCGCGGCCCGGG + Exonic
1007521230 6:42452864-42452886 CCCCCACCGCACCCTGGCCTCGG + Intergenic
1008518513 6:52340974-52340996 GTGCCACTGCACCGCAGCCTGGG - Intergenic
1008937165 6:57004458-57004480 CTGCCTCCTCACCGCGCCCTGGG + Intronic
1009723943 6:67511499-67511521 CTGCCACTGCACCCCAGCCTGGG - Intergenic
1009821730 6:68811509-68811531 ATCCCACCGCACTCCAGCCTGGG - Intronic
1010350473 6:74868194-74868216 CTCCCACTGCACTCCAGCCTGGG - Intergenic
1012180724 6:96149118-96149140 CTGCCACTGTACCGCAGCCTGGG + Intronic
1012937887 6:105387172-105387194 CTGCCACTGCACTGCGGCCTGGG + Intronic
1013379967 6:109558904-109558926 GTGCCACCGCACCCCAGCCTAGG - Intronic
1013498918 6:110727943-110727965 CTGCCACTGCACTGCAGCCTGGG + Intronic
1014724881 6:124962354-124962376 CTCCCCACGCGCCGCAGCCTCGG + Intergenic
1015511557 6:134042922-134042944 CTGCCACTGCACCCCAGCCTGGG + Intronic
1016431802 6:143992933-143992955 CTGCCACCGCACTCCAGCCTGGG + Intronic
1016813907 6:148286356-148286378 GTGCCACCGCACTCCGGCCTGGG + Intronic
1017668876 6:156750643-156750665 GTCCCACCGCACTCCAGCCTGGG - Intergenic
1017726884 6:157282472-157282494 CACCCACTGCACCGTGGTCTCGG + Intergenic
1018439305 6:163794674-163794696 CTGCCACTGCACTGCAGCCTGGG + Intergenic
1019498623 7:1353050-1353072 CTCCGTCTGCACCTCGGCCTGGG + Intergenic
1019677701 7:2324846-2324868 CTACCACTGCACTCCGGCCTGGG - Intronic
1019681805 7:2354781-2354803 CGCCCCCCGCCCCGCGGCCTTGG + Intronic
1019989423 7:4681770-4681792 TTGCCACCGCACTGCAGCCTGGG + Intergenic
1019991804 7:4697026-4697048 CTGCCACCGCACTCCAGCCTGGG + Intronic
1020185651 7:5957443-5957465 CTGCCACCGCACTCCAGCCTGGG + Intronic
1020226467 7:6284169-6284191 CTGCCACTGCACTGCAGCCTAGG + Intergenic
1020239256 7:6379789-6379811 ATGCCACTGCACCCCGGCCTGGG - Intronic
1020297265 7:6767313-6767335 CTGCCACCGCACTCCAGCCTGGG - Intronic
1020354430 7:7261106-7261128 GTGCCACTGCACCGCAGCCTGGG + Intergenic
1023251090 7:38261827-38261849 CTGCCACCGCACTCCAGCCTGGG + Intergenic
1023424544 7:40021451-40021473 CTGCCACCGCACTCCAGCCTGGG + Intronic
1023875032 7:44282289-44282311 CACCCACCCCACCACGGGCTGGG + Intronic
1024118055 7:46211497-46211519 CTGCCACAGCCCTGCGGCCTGGG + Intergenic
1025188312 7:56877810-56877832 GTGCCACCGCACTGCAGCCTCGG - Intergenic
1025683615 7:63699110-63699132 GTGCCACCGCACTGCAGCCTCGG + Intergenic
1025829804 7:65038755-65038777 CCACCTCCGCCCCGCGGCCTGGG - Intergenic
1025917059 7:65873755-65873777 CCACCTCCGCCCCGCGGCCTGGG - Intronic
1025962427 7:66234717-66234739 CTGCCACCGCACTCCGACCTGGG - Intronic
1026079877 7:67208276-67208298 GTGCCACCGCACCCCAGCCTGGG + Intronic
1026333035 7:69369588-69369610 CTGCCACTGCACCCCAGCCTGGG + Intergenic
1026923668 7:74174304-74174326 CTCCCCCCGCCCCGCCGCCGGGG - Exonic
1027766305 7:82347319-82347341 ATGCCACTGCACTGCGGCCTGGG - Intronic
1029190773 7:98770575-98770597 GTACCACCGCACCCCAGCCTGGG + Intergenic
1029241824 7:99168551-99168573 CTGCCACCACACCCCAGCCTGGG - Intergenic
1029420084 7:100467770-100467792 CCCCCGCCCCACCGGGGCCTGGG - Intronic
1029455601 7:100669722-100669744 CTGCCACCGCACTCCAGCCTGGG - Intergenic
1030258753 7:107541106-107541128 CTGCCACTGCACCCCAGCCTGGG + Intronic
1032145796 7:129379235-129379257 GTGCCACCGCACTGCAGCCTGGG + Intronic
1033632400 7:143171602-143171624 ATGCCACCGCACCCCAGCCTGGG + Intergenic
1034188304 7:149195775-149195797 CCCCCACGGCAGCGCGGCCATGG - Intronic
1034611593 7:152375426-152375448 ATCCCACTGCACCCCAGCCTGGG - Intronic
1035153206 7:156892622-156892644 CCGCCCCCGCCCCGCGGCCTCGG - Intronic
1035678280 8:1470117-1470139 ATGCCACCGCACTGCAGCCTGGG + Intergenic
1035694993 8:1589477-1589499 CTCCCACTGCACTCCAGCCTGGG - Intronic
1035919461 8:3661537-3661559 GTGCCACCGCACTGCAGCCTGGG - Intronic
1036175045 8:6529492-6529514 GTGCCACCGCACTGCAGCCTGGG - Intronic
1036932077 8:12965968-12965990 GTGCCACCGCACCCCAGCCTGGG + Intronic
1037374583 8:18213854-18213876 GTGCCACCGCACCCCGGCCTGGG - Intronic
1037463556 8:19137143-19137165 CTGCCACTGCACTCCGGCCTCGG - Intergenic
1037859364 8:22393712-22393734 GTGCCACCGCACCCCAGCCTGGG - Intronic
1037954203 8:23041487-23041509 CTGCCACCGCACTCCAGCCTGGG + Intronic
1038079514 8:24118032-24118054 ATGCCACCGCACTCCGGCCTGGG - Intergenic
1038594844 8:28878934-28878956 TGCCCACCGCACTCCGGCCTGGG + Intronic
1038734340 8:30155885-30155907 ATGCCACCGCACTCCGGCCTGGG - Intronic
1041791965 8:61706360-61706382 CTGCCACAGCACTGCAGCCTGGG + Intronic
1042686554 8:71448039-71448061 ATGCCACCGCACTGCAGCCTGGG - Intronic
1043537457 8:81221762-81221784 CTCCCACTGCACGTCAGCCTAGG - Intergenic
1043846551 8:85170215-85170237 CTGCCACTGCACCTCAGCCTGGG + Intergenic
1044128982 8:88496392-88496414 CTCCCACTGCACTCCAGCCTGGG + Intergenic
1044459831 8:92430615-92430637 CTGCCACTGCACTGCAGCCTGGG + Intergenic
1044527255 8:93265847-93265869 CTGCCACTGCACACCGGCCTGGG - Intergenic
1044822029 8:96161145-96161167 GTCCCTCCGCAGCGCGGCCCCGG + Intergenic
1045001520 8:97882432-97882454 CTGCCACTGCACCCCAGCCTGGG - Intronic
1045097620 8:98814725-98814747 ATGCCACCGCACCCCAGCCTGGG - Intronic
1046227712 8:111306593-111306615 CACCCACTGCACTGCAGCCTGGG + Intergenic
1049090703 8:140511636-140511658 CTGCCCCCTCACCGTGGCCTTGG - Exonic
1049196897 8:141320705-141320727 CTCCCACCTCCCCGAGACCTTGG + Intergenic
1049265982 8:141668177-141668199 CTCCCACTGTACCCCAGCCTGGG + Intergenic
1049396712 8:142404208-142404230 CCCCCACCGCCCCGCTGGCTGGG + Intergenic
1050191586 9:3032188-3032210 CTGCCACTGCACTGCAGCCTCGG - Intergenic
1054352632 9:64031171-64031193 ATGCCACCGCACTGCAGCCTGGG - Intergenic
1055840428 9:80496819-80496841 ATCCCACTGCACTCCGGCCTGGG - Intergenic
1056164836 9:83930894-83930916 ATGCCACCGCACTCCGGCCTGGG + Intergenic
1056318316 9:85413052-85413074 ATCCCACCGCACTTCAGCCTGGG + Intergenic
1056558483 9:87709558-87709580 ATGCCACCGCACCACAGCCTGGG - Intergenic
1057089644 9:92245807-92245829 CTGCCACTGCACTGCAGCCTGGG - Intronic
1057179859 9:93023842-93023864 GTGCCACCGCACTCCGGCCTGGG - Intronic
1058471893 9:105288389-105288411 ATGCCACCGCACCCCGGCCAGGG - Intronic
1058650718 9:107173516-107173538 GTGCCACTGCACCGCAGCCTGGG + Intergenic
1058872120 9:109211756-109211778 CTGCCACTGCACTGCAGCCTAGG - Intronic
1060634319 9:125188340-125188362 GTGCCACCGCACTCCGGCCTGGG + Intronic
1061113628 9:128593739-128593761 CCCCCACCTCACCCCAGCCTGGG + Intronic
1061328337 9:129877478-129877500 ATGCCACTGCACCGCAGCCTGGG + Intronic
1061454371 9:130686699-130686721 GTGCCACTGCACCGCAGCCTGGG - Intergenic
1062291794 9:135798614-135798636 CCCCCATGGCACTGCGGCCTCGG + Intergenic
1062455306 9:136634202-136634224 CTGCCACCGCACTCCAGCCTGGG - Intergenic
1062627360 9:137449336-137449358 CTCCCTCTGCACCGGGACCTGGG - Exonic
1203740983 Un_GL000218v1:266-288 ATGCCACCGCACTGCAGCCTGGG - Intergenic
1203473116 Un_GL000220v1:125779-125801 GCGCCACCGCACCGCAGCCTGGG - Intergenic
1203473512 Un_GL000220v1:130251-130273 GCGCCACCGCACCGCAGCCTGGG - Intergenic
1203553240 Un_KI270743v1:182076-182098 ATGCCACCGCACTGCAGCCTGGG - Intergenic
1185727010 X:2430214-2430236 GTGCCACTGCACCGCAGCCTGGG + Intronic
1185772689 X:2776802-2776824 CTCCCACTGCACTCCAGCCTGGG + Intronic
1185803548 X:3035311-3035333 CTCCCACTGCACTCCAGCCTGGG - Intergenic
1185837845 X:3361554-3361576 ATGCCACCGCACTGCAGCCTGGG - Intergenic
1185860445 X:3573821-3573843 GTGCCACCGCACTGCAGCCTGGG + Intergenic
1186211292 X:7253106-7253128 CTACCACCTCACCCCAGCCTGGG + Intronic
1186515276 X:10162058-10162080 CTACCACTGCACTGCAGCCTGGG - Intronic
1186671245 X:11769644-11769666 CTGCCACTGCACTGCAGCCTGGG - Intronic
1187419624 X:19122762-19122784 CGCCCACCCCACCGCAGCCGGGG + Intergenic
1187458678 X:19465994-19466016 GTGCCACCGCACTGCAGCCTGGG - Intronic
1187914145 X:24137712-24137734 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1189762653 X:44338467-44338489 CTGCCACTGCACCCCAGCCTGGG + Intronic
1189919423 X:45888938-45888960 CTCCCACTGCACTCCAGCCTGGG - Intergenic
1190085651 X:47393110-47393132 CTGCCACTGCACTGCAGCCTGGG + Intronic
1190186881 X:48243071-48243093 CTGCCACCGCACTCCAGCCTGGG + Intronic
1190258163 X:48780188-48780210 CCCCCACTGCACTGCAGCCTGGG + Intergenic
1190526344 X:51332795-51332817 CTCCCTCCGCTCCCCGGGCTCGG + Intronic
1190984413 X:55488505-55488527 CCCCACCCGCACCGCGGCCCAGG - Exonic
1191150195 X:57212189-57212211 ATCCCACTGCACCCCAGCCTAGG + Intergenic
1192445051 X:71204868-71204890 CTGCCACTGCACCCCAGCCTGGG - Intergenic
1192565882 X:72163089-72163111 GTGCCACCGCACTGCAGCCTGGG + Intergenic
1193653868 X:84173698-84173720 CTGCCACTGCACTGCAGCCTGGG - Intronic
1193801161 X:85937799-85937821 CTGCCACTGCACTGCAGCCTGGG + Intronic
1196337413 X:114553961-114553983 ATGCCACTGCACTGCGGCCTGGG - Intergenic
1196830965 X:119775233-119775255 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1197214775 X:123858082-123858104 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1198237712 X:134751078-134751100 ATGCCACCGCACTGCAGCCTGGG + Intronic
1198282220 X:135153617-135153639 CTGCCACTGCACTGCAGCCTGGG - Intergenic
1198288739 X:135218905-135218927 CTGCCACTGCACTGCAGCCTGGG + Intergenic
1199254459 X:145702437-145702459 CTGCCACCGCACTCCAGCCTGGG + Intergenic
1199772287 X:150982939-150982961 CTCCCACCGCACCGCGGCCTTGG - Intronic
1200149863 X:153946101-153946123 CTCCCACCCACCCTCGGCCTCGG + Intergenic
1201141752 Y:11034202-11034224 GTGCCACCGCACAGCAGCCTGGG - Intergenic
1201277202 Y:12310352-12310374 CTCCCACTGCACTCCAGCCTGGG + Intergenic
1201730468 Y:17197241-17197263 CACCCACCGCACTCCAGCCTGGG + Intergenic
1201797453 Y:17913662-17913684 CTGCCATAGCACCGCAGCCTAGG - Intergenic
1201804100 Y:17992297-17992319 CTGCCATAGCACCGCAGCCTAGG + Intergenic
1202358807 Y:24082596-24082618 CTGCCATTGCACCGCAGCCTAGG - Intergenic
1202511971 Y:25587518-25587540 CTGCCATTGCACCGCAGCCTAGG + Intergenic