ID: 1199772571

View in Genome Browser
Species Human (GRCh38)
Location X:150983977-150983999
Sequence GGCCACCGGGCGCTCCGCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199772571_1199772592 25 Left 1199772571 X:150983977-150983999 CCGTCGCGGAGCGCCCGGTGGCC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1199772592 X:150984025-150984047 CCTCTCGCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 3
3: 42
4: 326
1199772571_1199772581 -9 Left 1199772571 X:150983977-150983999 CCGTCGCGGAGCGCCCGGTGGCC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1199772581 X:150983991-150984013 CCGGTGGCCCGGGGGGGCGCGGG 0: 1
1: 0
2: 2
3: 38
4: 398
1199772571_1199772582 -5 Left 1199772571 X:150983977-150983999 CCGTCGCGGAGCGCCCGGTGGCC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1199772582 X:150983995-150984017 TGGCCCGGGGGGGCGCGGGCCGG 0: 1
1: 0
2: 7
3: 66
4: 676
1199772571_1199772579 -10 Left 1199772571 X:150983977-150983999 CCGTCGCGGAGCGCCCGGTGGCC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1199772579 X:150983990-150984012 CCCGGTGGCCCGGGGGGGCGCGG 0: 1
1: 0
2: 6
3: 47
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199772571 Original CRISPR GGCCACCGGGCGCTCCGCGA CGG (reversed) Intronic
900394623 1:2448139-2448161 GGGCACCTGGCGCTCCAGGAGGG - Intronic
901333107 1:8425528-8425550 GGTGACCGGGCCCTCCGTGAAGG + Intronic
901540108 1:9910136-9910158 GGCCGCCGCGCGCTGCGCGCCGG - Exonic
905626602 1:39493662-39493684 TGGCACTGGGCGCTCAGCGATGG - Intronic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
922587868 1:226749285-226749307 GGGCACCGGGCCCTCAGAGATGG + Intergenic
1065092729 10:22251870-22251892 GGGCACCAGGCGCTAGGCGAAGG + Intergenic
1065636989 10:27743465-27743487 GGCCGCCGGGAGCTCCGCAGCGG + Exonic
1069682497 10:70295326-70295348 GGCCACCTGGCGCTGTGCTAGGG - Intergenic
1070768138 10:79068144-79068166 GCGCCCCGGGCGCTCCGCGCCGG + Intergenic
1076821681 10:132942768-132942790 GGACGCCGGGGGCTCCGCGCGGG + Intronic
1077214811 11:1390830-1390852 GGCCACCGGGGCCTCCGGGCAGG + Intronic
1083593941 11:63910156-63910178 GGCCACTGGGCACTCTGTGATGG + Exonic
1084086443 11:66857304-66857326 GGCCGCCGGGCGCAGCGCGGGGG + Intronic
1087672913 11:101128182-101128204 GGCGCCCGGGCGCTCCCCGCTGG - Exonic
1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG + Exonic
1102924915 12:116819344-116819366 GGCCTCCGGGCGTCCCGCGCCGG - Intronic
1108727707 13:53200728-53200750 GGCCACCGTGCCCTGCGGGAAGG - Intergenic
1113878264 13:113608042-113608064 GGCCACCGTGCACTCAGCCACGG - Intronic
1121226276 14:92323812-92323834 GGCACCCAGGCGCTCCGGGATGG + Exonic
1122847727 14:104509983-104510005 GGCCACAGGAGGCTCCGTGAAGG + Intronic
1127763472 15:62164082-62164104 GGCCGCCGGGCACTGCGCGTTGG - Exonic
1128087177 15:64894393-64894415 AGGCACTGGGGGCTCCGCGAGGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1131510205 15:93045490-93045512 GCCCACCTGGCGCACCACGATGG + Exonic
1142163686 16:88573220-88573242 GGGCACCAGGCGCTCCGCTTAGG + Intronic
1148698670 17:49575786-49575808 CGCCAGGGGGCGCGCCGCGACGG + Intergenic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1153805585 18:8706220-8706242 GGCCACCGAGGTCACCGCGAGGG - Intronic
1163509493 19:17726592-17726614 GGCCAGCGTGCGCTCGGCGCCGG - Exonic
1167136408 19:47618787-47618809 GGCCACCAGGCGCTCCCTCAAGG - Intronic
927652177 2:24919697-24919719 GGCCACCGCGTGCTCCGGGACGG + Exonic
941649608 2:168079527-168079549 GGCCACCGGCCACTCCTAGATGG + Intronic
947506791 2:230713451-230713473 GGCCCCCGGGCGCCCCACGCCGG - Intronic
947718175 2:232352151-232352173 GGCCAGCCCGCGCCCCGCGAGGG - Intergenic
1173251642 20:41366780-41366802 GGCCGCCTGGCGCTTCGCGGCGG + Exonic
1175847021 20:62064838-62064860 GGCCGCCGGGGGCCCCGCGGGGG - Exonic
1176000773 20:62830380-62830402 GGACACCAGGGGCTCCGGGAGGG - Exonic
1176030066 20:63007456-63007478 GGCCACAGGGCGCCCCGAGCAGG - Intergenic
1176129360 20:63490018-63490040 GGCCACCGAGCACTCAACGAGGG - Intronic
1180796682 22:18609170-18609192 GGCAACTGGGCTCTCCTCGAGGG + Exonic
1181225042 22:21386101-21386123 GGCAACTGGGCTCTCCTCGAGGG - Exonic
1181253590 22:21548712-21548734 GGCAACTGGGCTCTCCTCGAGGG + Exonic
950683962 3:14603135-14603157 GGCCGCCAGGCGCTCCGCTCCGG + Intergenic
951146608 3:19234557-19234579 GGCCAGCGGGAGTTCCGCGTGGG - Intronic
952301357 3:32106848-32106870 GGGCACCGGGCACTGCGCGCAGG + Intronic
954249686 3:49358204-49358226 GGCCAGCGGGCGCGCCGAGAAGG + Exonic
969611087 4:8228162-8228184 GGCCACCAGGTGGTCCACGATGG - Exonic
969637006 4:8375102-8375124 GACCACCGTGAGCTCCACGAAGG + Exonic
972586208 4:40438830-40438852 GGCCGCCGGGTCCTCCGCCAAGG - Exonic
981508059 4:145525053-145525075 GGCCACCGGGCACTCCCACATGG - Intronic
985629875 5:1008838-1008860 GGCCACCGGGCGCAGGGCGCGGG - Exonic
990308891 5:54518969-54518991 GGCCACCGGCCGCTTCGAGGAGG + Exonic
992365511 5:76084932-76084954 AGCTACCGGGCGCTCCCCGGGGG + Intronic
998448458 5:142216414-142216436 GGCCACCCAGCGCTCGGCGCTGG - Intergenic
1001431726 5:171667623-171667645 AGCCACCGGGGGCTCCCGGAGGG - Intergenic
1002188441 5:177466859-177466881 GGCCCCCGGGCGCACCCTGACGG - Intronic
1004070846 6:12296098-12296120 GGCCACAGGGCTCTCCGTGGAGG - Exonic
1007471914 6:42096340-42096362 GGCCACCGGGCTCTCCTGGGTGG + Intergenic
1007614482 6:43172013-43172035 GGCCACCGGGGGCTACGGGCCGG + Exonic
1009336078 6:62492424-62492446 GGCCACCCGCAGCTCCGCAAAGG + Intergenic
1019714154 7:2530648-2530670 GGCTGCAGGGCGCTCAGCGAGGG + Intergenic
1020099834 7:5388663-5388685 GGGCCCCGGGCGCTCGTCGAAGG + Exonic
1024061537 7:45702434-45702456 GGCCATGGGCCGCTCCGCAAGGG + Intronic
1029495997 7:100895733-100895755 GGGCACCGTGCGCTCCCCGAGGG - Intronic
1029549975 7:101232504-101232526 GGCCGCCGGGCGCTGCGGGGAGG + Exonic
1029715137 7:102321560-102321582 GGCCTCCGGGGGCTCCTCGGCGG - Exonic
1034494320 7:151410657-151410679 AGCCGCCGGGCGCTCCGGGAGGG - Intronic
1038002644 8:23404264-23404286 GGCCAGAGGGAGCTCCGCGGGGG + Intronic
1046871285 8:119208353-119208375 GGGCTCCGGGCGCGCCGCGCGGG - Exonic
1049554704 8:143276035-143276057 GCCCGCCGGCCGCTCCGCGCTGG - Exonic
1055936825 9:81611768-81611790 GGCCTACGGGCGCTCCCCCATGG - Exonic
1060986813 9:127824831-127824853 GGCCAGCGGTAGCTCCACGAAGG + Exonic
1061002879 9:127912309-127912331 GGCCATCATGCGCTCCGTGAAGG + Exonic
1061682467 9:132249864-132249886 GCCCACCGGGAGCTCCGGGAGGG - Intergenic
1062609245 9:137366576-137366598 GGCCACATAGCGCTCCACGAGGG + Exonic
1186829849 X:13379272-13379294 GGCCAGCGGGCGCGCCGAGAAGG + Intergenic
1192216817 X:69164989-69165011 GGCCACGGAGTGCTCCGCAAAGG + Intronic
1199772571 X:150983977-150983999 GGCCACCGGGCGCTCCGCGACGG - Intronic