ID: 1199772901

View in Genome Browser
Species Human (GRCh38)
Location X:150985118-150985140
Sequence GCTGAACACAAGACCAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199772901 Original CRISPR GCTGAACACAAGACCAAAGC AGG (reversed) Intronic
901864596 1:12096211-12096233 GATGAGCACATGACCCAAGCAGG - Intronic
901933735 1:12614167-12614189 GCTGGATACCAGACCAAAGGCGG + Intronic
902902906 1:19532498-19532520 GATGAACACCAGACCTCAGCGGG + Intergenic
908316995 1:62942380-62942402 GCTGAAGACAAGGGCAAAGGCGG + Intergenic
909604655 1:77496296-77496318 GCTGAAGACAAGGCAAAATCTGG + Intronic
910503446 1:87921725-87921747 TTTGAACAGAAGACCAAAGTTGG - Intergenic
910589839 1:88918861-88918883 TCTGATCACAAGCCCAGAGCTGG - Intergenic
912101990 1:106220683-106220705 CCTGAGCAAAAGAACAAAGCTGG + Intergenic
913225974 1:116698560-116698582 GCTGGAAAAAAGACCAAAGGAGG + Intronic
913519567 1:119631995-119632017 GCTGAACTCATGACCACAACTGG + Intronic
915802770 1:158811551-158811573 ACTGAACACAATACATAAGCAGG + Intergenic
916490853 1:165301107-165301129 GCTTAACACAATTCCAAACCTGG + Intronic
916557239 1:165903726-165903748 GCTAAAGACAAGCTCAAAGCAGG - Intronic
919835145 1:201568231-201568253 GCTGCCCACAAGACTAAAACTGG - Intergenic
921670986 1:217923858-217923880 GTTTAACACAAGATCAAAGATGG - Intergenic
923277158 1:232406636-232406658 GTTGAACATAAGGCCAAGGCTGG + Intronic
924863403 1:247951228-247951250 CCTGAAAAAAAGAGCAAAGCTGG - Intronic
1063403220 10:5767999-5768021 GATGGACACAAGTCCAAGGCTGG + Intronic
1064601467 10:16997870-16997892 TCTGAACACAAGGCCAAGGGTGG + Intronic
1065041316 10:21699818-21699840 CCTGAGCAAAAGAACAAAGCTGG - Intronic
1065319008 10:24491687-24491709 GCTGGCCACAAGAACAATGCTGG - Intronic
1069233197 10:66037704-66037726 GATGAACACAAGGGCAAGGCAGG - Intronic
1072625092 10:97106106-97106128 CCTGACCACAAGACCAGAGTTGG - Intronic
1074333139 10:112540442-112540464 GCAGAATACAAGACCAAGTCTGG + Intronic
1077284407 11:1759328-1759350 GCTGAGAGCAAGACCACAGCTGG + Intronic
1077649891 11:3961326-3961348 GCTGAAAACAAGACCAGATGAGG + Intronic
1080507014 11:32924728-32924750 GCTGAAAATAAAACCAAACCTGG - Intronic
1081013644 11:37847906-37847928 GGTAAAGATAAGACCAAAGCTGG - Intergenic
1084766355 11:71311588-71311610 GCAGAACATTAAACCAAAGCTGG + Intergenic
1087948073 11:104189034-104189056 GCTGAAAACCAGGCAAAAGCAGG - Intergenic
1088075026 11:105837380-105837402 GCTGGATCCAAGACCACAGCTGG + Intronic
1089481915 11:118812652-118812674 GATGGACACATGACCCAAGCTGG - Intergenic
1091122663 11:133069456-133069478 GTTACACACAAGACCATAGCTGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092827201 12:12412062-12412084 CCTGAAAAGAAGAACAAAGCTGG - Intronic
1093306873 12:17531304-17531326 GTTGAACAAAAGAGCAAAGCTGG - Intergenic
1097298729 12:57995852-57995874 CCTGAAAAAAAGAACAAAGCTGG - Intergenic
1097579466 12:61436441-61436463 GCTGAACAGAAGAGAAAAGTAGG + Intergenic
1099219402 12:79894873-79894895 GCTGAAAGCAAGACGAAAGGCGG - Intronic
1101164148 12:102010665-102010687 ACTGAACGCAAGGCCAAAACTGG - Intronic
1104709279 12:130974050-130974072 GCTGAACTCAAGACCCAGGGGGG - Intronic
1106658244 13:31770534-31770556 CCAGAACACAAGAACAAAGTAGG + Intronic
1107424024 13:40275202-40275224 GCTGAAGAGGAGAACAAAGCAGG + Intergenic
1109854820 13:68112870-68112892 CCTGAACAGAAGAACAAAACTGG + Intergenic
1111799701 13:92966513-92966535 GCTGATGACAAGAACAAAGCCGG + Intergenic
1112569549 13:100581286-100581308 GCTGAACCTAAGACTGAAGCAGG + Intronic
1112803867 13:103140823-103140845 GCTGAGCAGAAGTCAAAAGCAGG - Intergenic
1112992834 13:105534910-105534932 CCTGAAAACAAGAACAAGGCTGG - Intergenic
1114591054 14:23865107-23865129 GCTGTCTACAATACCAAAGCAGG - Intergenic
1115159756 14:30380639-30380661 GAGTAACACAAGACCAAGGCAGG + Intergenic
1117219752 14:53591282-53591304 GCTGAACACAAGAACACAGAAGG + Intergenic
1118138847 14:63057317-63057339 GCTTAACGCAAGACCACACCTGG + Intronic
1120911856 14:89673924-89673946 GCTGCACACAAGACCTGGGCTGG - Intergenic
1124368447 15:29090151-29090173 GCTGAACAAAAGAGCAAGGCAGG + Intronic
1124951499 15:34326070-34326092 GCTGATCCAAATACCAAAGCAGG + Intronic
1126451595 15:48814523-48814545 GGGGAACACTAGACCCAAGCTGG + Intergenic
1127840222 15:62825226-62825248 ACTGGACTCAAAACCAAAGCCGG - Intronic
1127870772 15:63071552-63071574 GTTGAACAAAAGACCACAGGGGG - Exonic
1127930187 15:63590788-63590810 GTGGAACACCAGGCCAAAGCTGG + Exonic
1128454493 15:67825021-67825043 GCTGTATTCCAGACCAAAGCTGG - Exonic
1132296697 15:100740505-100740527 GGTGACGACAACACCAAAGCTGG - Intergenic
1133075319 16:3275799-3275821 ACTCAACACAAGACCACAACTGG - Intronic
1135906692 16:26518622-26518644 TGTGAACACATGACCTAAGCTGG + Intergenic
1140156575 16:72434936-72434958 GCAAAACACAGGACCAAAACGGG - Intergenic
1141447085 16:84067826-84067848 GATGAACAAAGAACCAAAGCTGG + Intronic
1141514875 16:84537212-84537234 GCTGGACACCTGACCCAAGCTGG - Intronic
1142294394 16:89210961-89210983 GCTGAATACAACACCAAACCTGG - Intergenic
1144316585 17:14068196-14068218 GCTTAACACTAGACCAATGAGGG - Intergenic
1144324790 17:14168599-14168621 GCTGCACAGAAGACAAGAGCTGG - Intronic
1147761974 17:42804345-42804367 GCTGAACACATGACACAAGACGG - Exonic
1147925323 17:43942289-43942311 GCAGAAAGCAAGACCCAAGCAGG + Intronic
1148172445 17:45533993-45534015 GCTGAAAAAATGTCCAAAGCAGG + Intergenic
1148276824 17:46311460-46311482 GCTGAAAAAATGTCCAAAGCAGG - Intronic
1148298940 17:46529044-46529066 GCTGAAAAAATGTCCAAAGCAGG - Intronic
1148363476 17:47033571-47033593 GCTGAAAAAATGTCCAAAGCAGG - Intronic
1148400209 17:47352528-47352550 CCTAAACAAAAGAACAAAGCTGG - Intronic
1149528380 17:57375951-57375973 GCTGCACACAAGTTCAAAGGCGG - Intronic
1150403652 17:64880909-64880931 GCTGAAAAAATGTCCAAAGCAGG + Intronic
1150800725 17:68280339-68280361 CCTGAAAAAAAGAACAAAGCTGG + Intronic
1151135594 17:71943378-71943400 GCAGAACACCAGGCCAAAGACGG + Intergenic
1154937798 18:21078601-21078623 CCAGAACAAAAGACCAAAGCAGG + Intronic
1155616355 18:27725896-27725918 GATGAAGATGAGACCAAAGCGGG + Intergenic
1157835254 18:50895907-50895929 GCTGAACCCAAGAACAAACAAGG + Exonic
1158313662 18:56187098-56187120 GCTGAACACAGGATCACTGCAGG + Intergenic
1163272500 19:16262629-16262651 GTTGAAGACAAGACCACAGTGGG - Intergenic
1167005482 19:46773882-46773904 GCTGAATACAAGACCAAGGGAGG - Intronic
1168600978 19:57718434-57718456 GCTCAACTCAAGACCACTGCTGG - Intronic
925790670 2:7483499-7483521 TCTAAACAAAAGAACAAAGCTGG + Intergenic
926133193 2:10318394-10318416 GCTGAACACAAACCCAAAGAAGG - Intronic
926413066 2:12625098-12625120 GCTGAACCAAAGACCTAGGCGGG - Intergenic
929278325 2:40049676-40049698 GCGGCACACAAGGTCAAAGCAGG + Intergenic
930996665 2:57727800-57727822 GCTGAACAGAAGCCCAAGCCAGG - Intergenic
932570298 2:72934930-72934952 GGTGAACACAAGAGCTCAGCGGG - Intronic
932887641 2:75561302-75561324 GCTGAATACAGGCTCAAAGCAGG - Intronic
938111080 2:128565454-128565476 GCTGCTCACAGCACCAAAGCAGG - Intergenic
938976032 2:136479823-136479845 TCTGACCACAAGCCCACAGCTGG - Intergenic
941665917 2:168244410-168244432 CCTGAACAGAAAACCAAAGGAGG - Intronic
943288505 2:186037341-186037363 GCAGAACAAAGGTCCAAAGCTGG + Intergenic
945279207 2:208019302-208019324 TCTGAAAACAAAACCAAACCTGG + Intronic
946774290 2:223121463-223121485 GCTGAACACCAGATCAAACATGG + Intronic
1168834631 20:869880-869902 GATGGACACAAGACCAATCCTGG + Exonic
1170720154 20:18870137-18870159 CCTGGACACAAGACTAAACCAGG - Intergenic
1170916076 20:20627370-20627392 AATGATAACAAGACCAAAGCCGG - Intronic
1171097497 20:22345658-22345680 GTTGAACATGAGAGCAAAGCAGG + Intergenic
1176525370 21:7862595-7862617 GCTGATTACAAGTCAAAAGCAGG - Intergenic
1177429893 21:20978597-20978619 ACTTAACAAAAGAACAAAGCTGG - Intergenic
1178659390 21:34492608-34492630 GCTGATTACAAGTCAAAAGCAGG - Intergenic
1179591738 21:42413548-42413570 CCTAAAGAGAAGACCAAAGCTGG - Intronic
1180630266 22:17224514-17224536 GCTGAAGGTAAGTCCAAAGCAGG + Intergenic
1182032033 22:27166990-27167012 GCAGAAGAGAAGACCAGAGCGGG + Intergenic
949168923 3:975090-975112 GATGAACACAATGCCAATGCAGG - Intergenic
950356580 3:12415340-12415362 GCTCACCACAGAACCAAAGCTGG + Intronic
950435812 3:12979272-12979294 GCTGATAACAGGATCAAAGCAGG - Intronic
951695993 3:25446310-25446332 GCTGAAAACTACACCAAATCTGG + Intronic
951710708 3:25582959-25582981 GTTGATGACAAGGCCAAAGCTGG + Intronic
951868833 3:27337499-27337521 CCTGAGCAAAAGAACAAAGCAGG + Intronic
952283999 3:31950290-31950312 ACTGAGCAAAAGACCCAAGCTGG + Intronic
955748890 3:62167949-62167971 GCTGAACAGAGGACCAGAGAGGG - Exonic
958014520 3:87923205-87923227 CCTGAGCAAAAGAACAAAGCTGG - Intergenic
958816453 3:98921598-98921620 GCTGAACACAAAATAATAGCCGG + Intergenic
960065801 3:113371279-113371301 CCTGAGCAAAAGAACAAAGCTGG + Intronic
960804748 3:121572712-121572734 GATGAACAGATGAACAAAGCTGG + Intronic
961962842 3:130869653-130869675 TCTGGATACAAGACCAAACCAGG + Intronic
963722390 3:148877380-148877402 GCTGCTCAGGAGACCAAAGCAGG + Intronic
965352657 3:167633472-167633494 GCTAAAGACAAGACAGAAGCTGG - Intronic
966273752 3:178140969-178140991 GCTAAACAGAAAACCACAGCAGG + Intergenic
966796372 3:183718229-183718251 ACTGAACACAAGAGCAAAGAGGG - Intronic
968746235 4:2362031-2362053 GCTGAACCCAGGACATAAGCTGG + Intronic
970488801 4:16550977-16550999 GCTGAAGAAAAGACGAAAGTTGG + Intronic
971623356 4:28886026-28886048 GCAGAACACAAGACCAATAAAGG - Intergenic
973057264 4:45676458-45676480 TCTGAACAAAAGAACAAAGCTGG - Intergenic
974342131 4:60627683-60627705 CCTGAGCAAAAGAACAAAGCTGG - Intergenic
974663909 4:64933141-64933163 GCTGAGCAAAAGAACAAAACTGG - Intergenic
977925171 4:102692467-102692489 ACTAAACACAAAACCAAACCCGG - Intronic
978277016 4:106964107-106964129 AGTGAACAAAAGAACAAAGCTGG - Intronic
981007931 4:139894684-139894706 GCTGAACACAAGGCCCTAACGGG + Intronic
981792131 4:148550229-148550251 GTTGAACACAAAACCAAGGCAGG - Intergenic
983371576 4:166865979-166866001 CCTAAACAAAAGAACAAAGCTGG + Intronic
983588398 4:169381025-169381047 TCTGAGCAAAAAACCAAAGCTGG + Intergenic
983949568 4:173623060-173623082 GCTAAGCAAAAGAACAAAGCTGG - Intergenic
984940132 4:184923869-184923891 GCTGAATGCAAGACCTCAGCAGG - Intergenic
986780884 5:11064612-11064634 GCAGAAGACAAGACCAAAGTTGG + Intronic
989343464 5:40403340-40403362 GCTAAACAAAAGAAGAAAGCGGG + Intergenic
992616474 5:78550515-78550537 GCTGAACACAAGACTGAAAAAGG + Intronic
994891709 5:105644176-105644198 CCTGAACACAAAATAAAAGCTGG - Intergenic
995739479 5:115340015-115340037 GCTGAACATAATACTGAAGCAGG + Intergenic
999649968 5:153755827-153755849 GCAGAGCCCAAGACCTAAGCAGG + Intronic
1000653878 5:163852358-163852380 CCTGGACACAAGACTAAACCAGG - Intergenic
1001612069 5:173010860-173010882 GTGGAACAGAAGAACAAAGCAGG + Intronic
1002423414 5:179162314-179162336 GGTGAACATACAACCAAAGCGGG + Intronic
1002678757 5:180942490-180942512 ACTGAATAAAAGAACAAAGCTGG + Intronic
1002803844 6:552448-552470 GCTGAACAAAAGAAAAATGCTGG - Intronic
1005277312 6:24233223-24233245 GCTCAACACAAAATCAAAGGAGG + Intronic
1005672418 6:28120483-28120505 GCTGAACACCAGACAAAAGGAGG - Intergenic
1006687505 6:35848553-35848575 TCTCAAAACAAGAACAAAGCTGG + Intronic
1010947947 6:82000004-82000026 GCAGAACACTAGACAAAATCAGG + Intergenic
1015228220 6:130882941-130882963 GCAGAATCCAAGACCAAATCAGG + Intronic
1017580756 6:155862381-155862403 TCTGAACAAAAGAACAAAGCTGG - Intergenic
1017782600 6:157727906-157727928 GATGGACAAAAGACCGAAGCAGG + Intronic
1017882433 6:158571384-158571406 GCAGATCACAAGGCCAAGGCGGG - Intronic
1018562164 6:165111827-165111849 ATTGAACAAAAGAACAAAGCTGG - Intergenic
1019749289 7:2718729-2718751 CCTGACCACAAGACCAAGCCCGG - Intronic
1020545865 7:9529400-9529422 GCTGCACACAAGTCCAGATCTGG + Intergenic
1021460227 7:20878755-20878777 GCTGAAAAAATGACCAAAGCAGG + Intergenic
1021464246 7:20923795-20923817 CCTAAACAAAAGAACAAAGCTGG - Intergenic
1021949542 7:25761373-25761395 GGTGAACACAAGATCAGAGCAGG + Intergenic
1021949960 7:25764980-25765002 GGTGAACACAAGATCAGAGCAGG + Intergenic
1022370589 7:29767538-29767560 GAAGAACAAAAGAACAAAGCTGG + Intergenic
1022986192 7:35656514-35656536 CCTGAACAAAAGAACAAAGCTGG + Intronic
1025147242 7:56515416-56515438 CCAGAAAACAAGAGCAAAGCTGG + Intergenic
1037607651 8:20450826-20450848 GCAGAAAACATGACCAAGGCTGG + Intergenic
1038574972 8:28697340-28697362 GGTGGACACACGACCCAAGCTGG + Intronic
1038862939 8:31407360-31407382 TCTGAAATCAAGAACAAAGCAGG + Intergenic
1040556233 8:48479493-48479515 CCTGAACACAACAACAAGGCAGG - Intergenic
1042070377 8:64926759-64926781 CCTAAGCAAAAGACCAAAGCTGG - Intergenic
1044308868 8:90669366-90669388 GTAGAACACAAAAACAAAGCTGG - Intronic
1045525239 8:102935910-102935932 GTTGAGCACATGACCCAAGCTGG + Intronic
1046926626 8:119797401-119797423 TATGAACACAAGACTAAAACAGG + Intronic
1048235755 8:132688517-132688539 GGTGAACACATGACCCAAGCTGG + Intronic
1048297310 8:133223844-133223866 GGTGAGCTCGAGACCAAAGCAGG - Intronic
1051131731 9:13869389-13869411 ACTGAGCAAAAGAACAAAGCTGG - Intergenic
1055614658 9:78058911-78058933 CCTAAACACAAAAACAAAGCTGG + Intergenic
1056134851 9:83622048-83622070 GGTTAACAAAAGACCAAAGGAGG + Intergenic
1186501560 X:10054997-10055019 GCTGACCACAAGACAGCAGCTGG - Intronic
1187555955 X:20351320-20351342 GCTGAACAAAATATAAAAGCAGG - Intergenic
1193793972 X:85850761-85850783 CCTGAACAAAAGAACAAAGCTGG + Intergenic
1194220251 X:91181481-91181503 CCTAAACAAATGACCAAAGCTGG - Intergenic
1194580737 X:95667136-95667158 GCTGAAAAAAAGAGCAATGCAGG + Intergenic
1196892681 X:120306238-120306260 GGTAAACACAGGAGCAAAGCCGG + Intronic
1197029680 X:121798580-121798602 CCTAAACAAAAGAACAAAGCTGG - Intergenic
1198494014 X:137172296-137172318 GGTCAACACAATACCAAATCTGG + Intergenic
1198813435 X:140560517-140560539 CCTGATCAAAAGAACAAAGCTGG - Intergenic
1199547731 X:149024733-149024755 CCTGAGCAAAAGAACAAAGCTGG - Intergenic
1199588760 X:149445481-149445503 CCTAAACAAAAGAACAAAGCTGG - Intergenic
1199772901 X:150985118-150985140 GCTGAACACAAGACCAAAGCAGG - Intronic
1199779277 X:151043693-151043715 GGTGAACACATGACTGAAGCTGG - Intergenic
1200556766 Y:4645233-4645255 CCTAAACAAATGACCAAAGCTGG - Intergenic
1200815934 Y:7532292-7532314 CCAAAACACAAGACTAAAGCCGG + Intergenic
1202080221 Y:21076446-21076468 TCTGAAAACAGGACAAAAGCAGG - Intergenic