ID: 1199773329

View in Genome Browser
Species Human (GRCh38)
Location X:150989243-150989265
Sequence GCATCCAGGAGACCAGCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 284}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199773329_1199773343 12 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773343 X:150989278-150989300 GTGGGATGGGGTGGTGGGGTAGG 0: 1
1: 2
2: 27
3: 332
4: 2862
1199773329_1199773335 -2 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773335 X:150989264-150989286 GCCAGTGAGGGTATGTGGGATGG 0: 1
1: 0
2: 1
3: 18
4: 289
1199773329_1199773340 6 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773340 X:150989272-150989294 GGGTATGTGGGATGGGGTGGTGG 0: 1
1: 0
2: 15
3: 145
4: 1209
1199773329_1199773346 18 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773346 X:150989284-150989306 TGGGGTGGTGGGGTAGGGGACGG 0: 1
1: 9
2: 197
3: 2257
4: 15540
1199773329_1199773344 13 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773344 X:150989279-150989301 TGGGATGGGGTGGTGGGGTAGGG 0: 1
1: 2
2: 13
3: 213
4: 2330
1199773329_1199773334 -6 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773334 X:150989260-150989282 GGATGCCAGTGAGGGTATGTGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1199773329_1199773345 14 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773345 X:150989280-150989302 GGGATGGGGTGGTGGGGTAGGGG 0: 1
1: 2
2: 24
3: 225
4: 1866
1199773329_1199773338 0 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773338 X:150989266-150989288 CAGTGAGGGTATGTGGGATGGGG 0: 1
1: 0
2: 3
3: 39
4: 406
1199773329_1199773339 3 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773339 X:150989269-150989291 TGAGGGTATGTGGGATGGGGTGG 0: 1
1: 1
2: 7
3: 84
4: 718
1199773329_1199773342 8 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773342 X:150989274-150989296 GTATGTGGGATGGGGTGGTGGGG 0: 1
1: 0
2: 3
3: 115
4: 845
1199773329_1199773337 -1 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773337 X:150989265-150989287 CCAGTGAGGGTATGTGGGATGGG 0: 1
1: 0
2: 0
3: 22
4: 256
1199773329_1199773333 -7 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773333 X:150989259-150989281 TGGATGCCAGTGAGGGTATGTGG 0: 1
1: 0
2: 2
3: 21
4: 240
1199773329_1199773341 7 Left 1199773329 X:150989243-150989265 CCTGCTGCTGGTCTCCTGGATGC 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1199773341 X:150989273-150989295 GGTATGTGGGATGGGGTGGTGGG 0: 1
1: 0
2: 4
3: 59
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199773329 Original CRISPR GCATCCAGGAGACCAGCAGC AGG (reversed) Exonic
900483178 1:2909239-2909261 GCATCCAGGCGCCCAGGGGCTGG + Intergenic
900536084 1:3178468-3178490 GCCTCCGGGAGAACAGCAGCTGG - Intronic
901027799 1:6288189-6288211 GCACCCAGGGGACCAGCACAGGG - Intronic
902299159 1:15489176-15489198 GCATCCTGGGGACCTGAAGCAGG + Intronic
902513290 1:16977413-16977435 GCAGCCAGGAGGCCAGCAACAGG - Intronic
902731613 1:18373626-18373648 GCACACAGGAGCCCAGGAGCCGG + Intronic
903134428 1:21300187-21300209 GCAGCCAGCAGGCCAGCAGCAGG - Intronic
904396457 1:30225449-30225471 GATTCCAGGTGAACAGCAGCCGG - Intergenic
904827040 1:33280517-33280539 TGCTCCAGGAGCCCAGCAGCGGG + Intronic
906781617 1:48577715-48577737 GCATCCAGCAGAGCTGCAACTGG + Intronic
907324242 1:53626455-53626477 GCATCCAGGGGACCCTGAGCTGG + Intronic
908391938 1:63691116-63691138 GCTGCCAGGAGACCAGGAGAAGG + Intergenic
908418971 1:63940873-63940895 GCATCCAGGTGTCCAGATGCAGG + Intronic
908599822 1:65726560-65726582 AGATCCAGGAGACCAGCTGGAGG + Intergenic
908607290 1:65812416-65812438 GGATCAGGGAGAGCAGCAGCAGG - Intronic
909137997 1:71826068-71826090 GCATCCAGGAGACCTGGCACTGG - Intronic
913144428 1:115976151-115976173 GCCTACAGGGGACCCGCAGCTGG - Intergenic
915654412 1:157347672-157347694 TCATACAGGAGAGCTGCAGCTGG - Intergenic
915973922 1:160372613-160372635 ACATCCAGGAGCCCTGGAGCTGG - Exonic
916679863 1:167094299-167094321 ACATGAAGGATACCAGCAGCTGG - Intronic
920006516 1:202837246-202837268 GCATGCAGGAGACCCAGAGCAGG - Intergenic
920701167 1:208219050-208219072 GCATCCATGAAATCACCAGCGGG + Intronic
920706213 1:208252506-208252528 TTCTCCAGGAGACCAGGAGCTGG - Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1064960435 10:20958046-20958068 GCATTCAGGGTACCTGCAGCAGG - Intronic
1067327822 10:45286611-45286633 GCACCCAGGAGCACAGCACCAGG - Intergenic
1067448599 10:46367860-46367882 ACATCCAGGAGAGCAGCTCCAGG + Intergenic
1067588771 10:47492905-47492927 ACATCCAGGAGAGCAGCTCCAGG - Intergenic
1067635897 10:48000996-48001018 ACATCCAGGAGAGCAGCTCCAGG - Intergenic
1067913147 10:50367532-50367554 ACCTCCAGGAGACCAGCAGAAGG - Intronic
1069218105 10:65848049-65848071 GTATGCAGCAGACCGGCAGCTGG - Intergenic
1071390543 10:85170997-85171019 GGATCCTGGAGAGCAGCAGGAGG + Intergenic
1071485732 10:86101169-86101191 AGATCCAGGAGAGGAGCAGCAGG + Intronic
1071711153 10:88050843-88050865 GCAGCCTTGAGACCAGCTGCAGG + Intergenic
1072527852 10:96289859-96289881 GCATCCATGGGACCAGCAGAAGG - Intergenic
1072711447 10:97718230-97718252 GCAGAAAGGAGGCCAGCAGCAGG - Intergenic
1072887085 10:99287241-99287263 GGATCAAGGAGAGAAGCAGCAGG + Intergenic
1073301545 10:102473975-102473997 GCAGCCAGGTGCCCAGCAGCGGG - Exonic
1073716562 10:106114756-106114778 GCATCCAGCAGAGCAGCTACCGG - Intergenic
1075831496 10:125415687-125415709 GCCTGAAGGAGACCAGCAGTGGG - Intergenic
1075849146 10:125573535-125573557 GCAGCCAGGAGGGCAGCAGAGGG - Intergenic
1075852478 10:125600444-125600466 GAGTCCAGGATTCCAGCAGCAGG - Intronic
1076542913 10:131225468-131225490 GTATCCAGGACACCAGCTGGAGG + Intronic
1076697811 10:132255598-132255620 GCACCCAGGAGAGGAGCAGGGGG + Intronic
1076817108 10:132920451-132920473 GCAGCCAGCAGAGCAGCAGGAGG - Intronic
1077232311 11:1463268-1463290 GCCTGGAGGAGGCCAGCAGCAGG + Intergenic
1077372288 11:2188754-2188776 GTATCCAGGACAGCAGCCGCAGG + Intergenic
1077989870 11:7396232-7396254 GGATGCAGGAGACCAGGAGTAGG - Intronic
1078531017 11:12136877-12136899 GCATTACGGAGACCAGCAGCAGG - Intronic
1079287802 11:19154972-19154994 ACATCTAGGAGACAACCAGCTGG - Intronic
1080960321 11:37150170-37150192 GGAGCCAGGAGAACAGCAGGAGG + Intergenic
1083856900 11:65397476-65397498 GCAGCCAGGAGACCAGAGGATGG + Intronic
1084170635 11:67399261-67399283 GCGCCCAGGAGACCAGTGGCGGG - Intronic
1084256774 11:67948094-67948116 CCATCTCGTAGACCAGCAGCTGG + Intergenic
1084815999 11:71647179-71647201 CCATCTCGTAGACCAGCAGCTGG - Intergenic
1085796040 11:79540865-79540887 TCTTCCAGGTGAGCAGCAGCTGG + Intergenic
1086475664 11:87170692-87170714 TCATACAGGAGACCTCCAGCTGG - Intronic
1089201935 11:116729839-116729861 GCATCCAAGCGCCCCGCAGCAGG - Intergenic
1089696627 11:120219871-120219893 GCCTGCAGGAGCCCAGCTGCAGG + Intronic
1090402462 11:126457989-126458011 GCCACCAGGAGCCCAGCAGCAGG - Intronic
1091592651 12:1854030-1854052 GCACCCAGGTGACGAGGAGCTGG - Exonic
1092020979 12:5202002-5202024 TCACTCAGGAGGCCAGCAGCTGG + Intergenic
1092413167 12:8269667-8269689 GCATCCAGGAGCACATGAGCTGG + Intergenic
1092427007 12:8382867-8382889 CCATCTTGTAGACCAGCAGCTGG + Intergenic
1092637325 12:10466293-10466315 GCATACAGGAGAGCTCCAGCTGG - Intergenic
1092752302 12:11730196-11730218 CCATTTAAGAGACCAGCAGCAGG + Intronic
1093664388 12:21794952-21794974 TCATACAGGAGAGCTGCAGCTGG - Intergenic
1093757510 12:22868868-22868890 GCATCCAGGACCCTAGTAGCTGG + Intergenic
1096201879 12:49689807-49689829 GCAGCCAGGAGCCCTGCTGCTGG - Intronic
1096944651 12:55391713-55391735 GCTCAGAGGAGACCAGCAGCAGG + Intergenic
1097332675 12:58349382-58349404 GCAACCAAAAGACCAGCAGCTGG - Intergenic
1097335451 12:58377671-58377693 GCATGCAGGCCACCAGCAGAAGG - Intergenic
1100672764 12:96834909-96834931 GCTCACAGGAGACCTGCAGCAGG + Intronic
1102800145 12:115725014-115725036 GCATCCAGGAGGAAGGCAGCTGG + Intergenic
1104283245 12:127397606-127397628 GAATTCTGGAGACCAGCAGTGGG + Intergenic
1104485820 12:129150591-129150613 CCACCCAGGTGACCAGCAGGAGG + Intronic
1105637455 13:22229095-22229117 ACATCCAGGAGACAATCAGAAGG - Intergenic
1107400306 13:40062888-40062910 GGATCCATGAAAACAGCAGCTGG + Intergenic
1110696685 13:78499133-78499155 GTATCCAGGATTCCAGCAGTAGG + Intergenic
1112181909 13:97091381-97091403 GCATATAGGACTCCAGCAGCAGG + Intergenic
1112452364 13:99524234-99524256 GAAGCCAGGAGACCAGTAGGAGG + Intronic
1115940255 14:38601218-38601240 GCATACAGGAGAGCTCCAGCTGG - Intergenic
1116809167 14:49523091-49523113 GCATCAAGGAGACCAGTAGAAGG - Intergenic
1119103005 14:71897462-71897484 GAGACCATGAGACCAGCAGCAGG - Intergenic
1119692217 14:76683440-76683462 CCATCCAGCTGACCAGCAGCTGG - Intergenic
1120807667 14:88770542-88770564 GGATCCAGTACACAAGCAGCAGG + Intronic
1120946235 14:90000187-90000209 GCTTCTTGGAGACCAGCAGGAGG + Intronic
1125293465 15:38175763-38175785 CCATCCAGGAGTTCATCAGCAGG + Intergenic
1126105494 15:45144410-45144432 TCATCCAGCAGACCCGGAGCAGG - Intronic
1127966891 15:63929330-63929352 GCATCCAGGGGAGCAGCCTCAGG - Intronic
1128386698 15:67154192-67154214 CCATCCTCCAGACCAGCAGCTGG - Intronic
1129431962 15:75505632-75505654 GCATCCTGGTAACCAGCTGCTGG + Intronic
1129707375 15:77802457-77802479 GCAGCCAGGAGGCCTGCAGAGGG + Intronic
1129781917 15:78277868-78277890 GCATCCAGGAAACCTGCCGTTGG + Intronic
1130887694 15:88107869-88107891 GCATCCAAGAGACCAACAAGCGG + Intronic
1132864214 16:2085660-2085682 GCATCCCACACACCAGCAGCGGG + Intronic
1133371251 16:5247498-5247520 CCATCTTGTAGACCAGCAGCTGG - Intergenic
1133479375 16:6155232-6155254 GCATCCAGGAGACAAGCCCTAGG + Intronic
1134233196 16:12445350-12445372 GCATACAGGAGCCCTGAAGCGGG - Intronic
1135551324 16:23400446-23400468 GCTTCCAGGAGACCAAGAGCAGG + Intronic
1139709694 16:68766425-68766447 AAATCCAGGGGACCAGTAGCAGG + Intronic
1140436590 16:74951910-74951932 ACATCCAGTGTACCAGCAGCTGG - Intronic
1141034449 16:80615549-80615571 GCTTACAGGAGACCCACAGCAGG - Intronic
1141216737 16:82032222-82032244 GCTTCCAGGAGGCCTGCTGCAGG - Intergenic
1141996188 16:87637791-87637813 CCACCCAGGAGGCCAGCATCTGG - Intronic
1142223360 16:88865860-88865882 GCCTCCAGGAGTGCAGCAACAGG - Exonic
1142236606 16:88925381-88925403 GCCTCCAGGAGATCTGCAGGGGG + Intronic
1142711626 17:1726794-1726816 CCATCCAGGAGACCACAGGCCGG + Exonic
1143562175 17:7702725-7702747 GCATCCTGGAGACAAGGAACAGG - Exonic
1144390014 17:14784645-14784667 GCTTTCAGGAGACCCGCAGTGGG - Intergenic
1145828903 17:27898993-27899015 GAATCCAGGGAACCAGCAGAAGG - Intergenic
1148238227 17:45983377-45983399 GCTTCTAGGAGACCTGCACCAGG + Exonic
1148860350 17:50601319-50601341 GCATCCCGGGGACCAGGATCTGG - Intronic
1150574308 17:66416441-66416463 GCATCCATGTGGCCGGCAGCTGG + Intronic
1152379303 17:79934239-79934261 GTATCCAGGGAACCAGCTGCCGG + Exonic
1152599923 17:81257090-81257112 GCATGCAGGAGAGCTCCAGCAGG - Intronic
1152741652 17:82021028-82021050 GCACCCAGGAGCCCAGAAACAGG + Intronic
1153192950 18:2562743-2562765 GAATAAAGGATACCAGCAGCTGG + Intronic
1153620522 18:6973323-6973345 GAAGCCAGGAGGCCAGCAGGGGG - Intronic
1155505457 18:26528556-26528578 GCAGGCAGCAGAGCAGCAGCTGG - Intronic
1158293748 18:55971220-55971242 GCAGCAAGGACAGCAGCAGCAGG - Intergenic
1158817852 18:61124758-61124780 TCATCCAGGTGACGTGCAGCAGG - Intergenic
1160292374 18:77606662-77606684 GCATCCAGGAGACCTGGAGAAGG + Intergenic
1160528278 18:79549629-79549651 GAATTCAGGAGACAAGCGGCTGG - Intergenic
1160759048 19:773335-773357 GCATCCAGGGGCCCTGGAGCTGG - Intergenic
1160905325 19:1449363-1449385 GCATCCAGGACACCTGGAGATGG + Intronic
1161477077 19:4492007-4492029 GCCTCCAGGAGCCCACCATCTGG + Intronic
1162789793 19:13056918-13056940 GGATCCAGGAAACAAGCAGGTGG - Intronic
1163282063 19:16324463-16324485 GCATCCCGGGGACCTGGAGCGGG - Intergenic
1163609537 19:18293734-18293756 GGATCCATGATACCAGCAGCAGG + Intergenic
1164855372 19:31516885-31516907 GCATCCTGGGGGCCAGCAGGGGG + Intergenic
1165105259 19:33465452-33465474 GAATCAAGGAGACCAGTAGAGGG - Intronic
1165355291 19:35300235-35300257 GCATCCAGGTCAGCAGCGGCGGG - Exonic
1166666334 19:44682661-44682683 GGATCCAGGAGCCCCGAAGCCGG + Intronic
1167156577 19:47742702-47742724 GCTTCCAGGGGGCCAGGAGCAGG - Exonic
1167603142 19:50466100-50466122 GCATCCACATGACCAGCAGGGGG - Intronic
1167821446 19:51932128-51932150 GCCTCCAGGAGCCCAGCGCCAGG + Intronic
1168279014 19:55294112-55294134 GCCTCCTGGAGACCAGCTGCGGG + Exonic
926554573 2:14341936-14341958 GCAGGCAGGAGACCTGCAGTGGG - Intergenic
927174509 2:20396171-20396193 GCCTCCAGTAGCCCAGCAGGTGG + Intergenic
927897900 2:26796652-26796674 GCTTCCAGCAGAGCAGCAGTGGG - Intronic
928103910 2:28455315-28455337 GGAGTCAGGAGCCCAGCAGCCGG - Intergenic
929354436 2:41002530-41002552 ACATCCAGGAGTCCAGGAGCTGG - Intergenic
929923880 2:46193546-46193568 CCATACAGGAGAGCAGCAGAAGG + Intergenic
930858080 2:56040415-56040437 GCATCCAGGGAACAAGCAGCTGG + Intergenic
931191385 2:60003615-60003637 GAATCCAGAAGACCTGCAGTAGG - Intergenic
935286706 2:101570976-101570998 GAATCAAGGAAACCAACAGCAGG - Intergenic
935389623 2:102536688-102536710 GCATCCAGTAGTGCAGCAGAGGG + Intergenic
936892846 2:117392526-117392548 ACATCCAGCAGAGCAGCAGGAGG - Intergenic
937222552 2:120350146-120350168 GCCTCCAGGATACCAGCAAATGG + Exonic
937464943 2:122124537-122124559 TCATACAGGAGAGCTGCAGCTGG - Intergenic
937494039 2:122399295-122399317 GCATCTGTGAGACCAGCAGGAGG + Intergenic
937937748 2:127259593-127259615 GCATTCCAGAGACCAGCATCAGG + Intronic
938121378 2:128636610-128636632 TCACCAAGGAGAGCAGCAGCAGG - Intergenic
939171425 2:138700740-138700762 GCATCCAAGAAACAAGCAGGAGG - Intronic
939435663 2:142174114-142174136 ACATCCAGGAGACCAGTAGATGG - Intergenic
941131106 2:161651295-161651317 GCTTTCAGGAGACCAGCAGTGGG - Intronic
942122497 2:172792204-172792226 GCAGCAAGGACAGCAGCAGCTGG - Intronic
944166897 2:196732606-196732628 GATTCCAAGAGCCCAGCAGCCGG + Exonic
945590504 2:211723565-211723587 GCATCTAGTAGACCATCATCAGG - Intronic
946081189 2:217119902-217119924 GAAGCCAAGAGACCTGCAGCTGG - Intergenic
946495634 2:220192748-220192770 GCATTCAGGAGACCAGAAGTGGG - Intergenic
946500775 2:220245147-220245169 GCATCTAGGAGACCAAGAGATGG - Intergenic
947083020 2:226419823-226419845 GCAGCCTTGAGACCAGCTGCAGG - Intergenic
1168765791 20:381101-381123 GCCTCCAGGGCACCAGCAGGTGG - Exonic
1168921187 20:1537555-1537577 TCATCCAGGAGCCCAGGAACAGG + Intronic
1168983379 20:2026701-2026723 GCAGACAGGAGACCTGCAGTGGG + Intergenic
1169111959 20:3039953-3039975 GGACCCAGGAGACCTGCAGGAGG + Intergenic
1171489992 20:25510146-25510168 GCAGCCAGAAGGCCAGCAGCTGG - Intronic
1171994485 20:31721655-31721677 GGATCCAGGAGAACGGCGGCTGG - Exonic
1172945262 20:38682692-38682714 TCATCCAGAAGACCACCAGATGG + Intergenic
1173421133 20:42902079-42902101 GCATGCAGGAAACCAGGAGATGG + Intronic
1173999001 20:47360720-47360742 CCAGCCAGGCGAGCAGCAGCAGG + Intergenic
1175691061 20:61066349-61066371 GCCTCCTGCTGACCAGCAGCAGG + Intergenic
1175691323 20:61067868-61067890 GCCTCCTGCTGACCAGCAGCGGG - Intergenic
1175829060 20:61952181-61952203 GCAGCGAGGGGCCCAGCAGCAGG - Intergenic
1176073521 20:63238459-63238481 TCACCCAGGAGCCCAGCAGCTGG - Exonic
1177147612 21:17423341-17423363 GCATCCAGGTAAGCTGCAGCTGG + Intergenic
1178120678 21:29467046-29467068 GCAGCAAAGAAACCAGCAGCGGG - Intronic
1179983984 21:44911012-44911034 GCACCCAGGACAGCTGCAGCGGG + Intronic
1180955527 22:19739648-19739670 GCTTCCAGGGGACCACCGGCTGG - Intergenic
1181466416 22:23112932-23112954 CCAGCCAAGAGACCAGGAGCAGG + Intronic
1183379249 22:37482710-37482732 GCATCCTGGAGACCACAGGCTGG + Intronic
949599357 3:5581415-5581437 GCATCTAGGATCCCAGCTGCTGG + Intergenic
949670329 3:6392562-6392584 GCATCTAGGAGAGCAGTGGCTGG - Intergenic
954465631 3:50652944-50652966 TCACCCAGGTGACCAGCAGGTGG - Intergenic
959801078 3:110495761-110495783 TCATACAGGAGAGCTGCAGCTGG + Intergenic
961282431 3:125774523-125774545 CCATCTTGTAGACCAGCAGCTGG - Intergenic
961328559 3:126125876-126125898 GCATCCAGGACAGAAACAGCAGG - Intronic
962466816 3:135668175-135668197 GCATTCATGAGGGCAGCAGCTGG + Intergenic
962640057 3:137376701-137376723 TCATACAGGAGAGCTGCAGCTGG - Intergenic
963880273 3:150520614-150520636 AGCTCCAGGGGACCAGCAGCTGG + Intergenic
965820030 3:172676038-172676060 GCATGCAGGGGAGCAGCAGTTGG - Intronic
966588599 3:181654269-181654291 GTAGGCAGCAGACCAGCAGCAGG + Intergenic
966896427 3:184448522-184448544 GCAACCAGGAGCCAAGCAACAGG + Intronic
967090731 3:186132784-186132806 TCAGCCTGGAGACCAGCAGGTGG + Intronic
967273436 3:187750064-187750086 GCATGAAGGAAAGCAGCAGCTGG + Intergenic
967891070 3:194364988-194365010 GCCTCTAGGAGCCCAGCACCTGG + Intronic
968696648 4:2033622-2033644 TCATTCAGGAGAGCTGCAGCTGG - Intronic
968909897 4:3472446-3472468 GTATCCTGGAGCCCAGCTGCCGG + Intronic
969626780 4:8309622-8309644 GGCTCCAGGTGACCAGCATCAGG + Intergenic
969657705 4:8507684-8507706 GCCTCCAGGTGACCAGGGGCAGG - Intergenic
969738657 4:9008480-9008502 CCATCTCGTAGACCAGCAGCTGG - Intergenic
969872719 4:10115006-10115028 CCCTCCAGGAGGCCAGCAACTGG - Intronic
972093513 4:35318658-35318680 GCATTCTGAAGGCCAGCAGCAGG - Intergenic
972169921 4:36333607-36333629 GGATCCAGCAGAGCAGCAGTAGG + Intronic
976456769 4:85256858-85256880 GAATCAAGTTGACCAGCAGCAGG - Intergenic
976698353 4:87942196-87942218 TCATACAGGAGAGCACCAGCTGG + Intergenic
977323773 4:95549557-95549579 GCGCCCAGGAGACCAGCTGTGGG + Intergenic
981247952 4:142562530-142562552 GCTTCAAGGAGACCAAGAGCAGG + Intronic
982767916 4:159369066-159369088 GCTTCCACGAAACCAGTAGCTGG + Intergenic
983275858 4:165616480-165616502 GCCTCCAGGAAACCAAAAGCAGG + Intergenic
985632074 5:1018940-1018962 GCATCTAGGGGAGCAGCAGGTGG + Intronic
985848102 5:2368802-2368824 GCAACCAGGAGATCACAAGCAGG - Intergenic
985890780 5:2713995-2714017 GGACCCAGAAGACCAGCAGCAGG + Intergenic
990023789 5:51160342-51160364 GCTTAGAGGAGACCAGCAGTGGG - Intergenic
990611087 5:57457620-57457642 GCTTCTAGGGCACCAGCAGCTGG - Intergenic
990900597 5:60744735-60744757 GCATCCAGGAGACCACACCCAGG - Intergenic
990981352 5:61604981-61605003 GGTTCAAGGACACCAGCAGCAGG - Intergenic
991537453 5:67686537-67686559 GCATCAATGAGACCATCAGGAGG + Intergenic
993829448 5:92736577-92736599 ACATCAAGGAATCCAGCAGCTGG - Intergenic
997865752 5:137461341-137461363 GCATCCAAGACACTGGCAGCTGG + Intronic
998371809 5:141666598-141666620 GCAGCCCGGGGCCCAGCAGCTGG + Exonic
999984007 5:156985181-156985203 TCATACAGGAGACCTCCAGCTGG + Intergenic
1000234388 5:159344222-159344244 GCACACAGGAGAGCAGGAGCAGG + Intergenic
1000969550 5:167698515-167698537 CCACCCAGGAGACCAGGACCTGG - Intronic
1001565190 5:172695590-172695612 GCTTCCAGAAGCCCAGCAGTGGG + Intergenic
1002637216 5:180614390-180614412 AGACCCAGGAGAACAGCAGCAGG - Intronic
1002680606 5:180960001-180960023 GCATCCATGAGTGCAGAAGCTGG - Intergenic
1003675949 6:8204398-8204420 AAATCCAGGGGAGCAGCAGCTGG - Intergenic
1005996270 6:30933337-30933359 GCATGGAGGAGAAGAGCAGCAGG + Intergenic
1006171327 6:32095101-32095123 GCATCCACGGGGCCAGGAGCCGG + Intronic
1006646054 6:35515010-35515032 GGCTCCACGAGACCAGCAGGTGG + Intergenic
1007295323 6:40816708-40816730 GCATCCAGGGCACCAGAAGGAGG + Intergenic
1007360685 6:41353218-41353240 GCAGCCAGAGGACCAGCAGGAGG + Intergenic
1007400313 6:41599276-41599298 GCATCATGGAGACCCGCAGGCGG + Exonic
1007914082 6:45544713-45544735 GCATCCAGGTGACCTTGAGCTGG - Intronic
1009209352 6:60843668-60843690 ATTTCCAGAAGACCAGCAGCAGG + Intergenic
1009229342 6:61043552-61043574 GCCCCCAGGAGACCAGCAAAAGG - Intergenic
1010047147 6:71458535-71458557 GGACCCAGAAGAACAGCAGCTGG - Intergenic
1011264013 6:85497037-85497059 GCAACCAGGAGGCCAGGGGCGGG - Intergenic
1012859818 6:104545684-104545706 GCAACCAGGAGACCATTAGGAGG + Intergenic
1013073976 6:106754344-106754366 GGATCCAGAAGGCCAGGAGCAGG + Intergenic
1018043560 6:159946201-159946223 GGATTCATCAGACCAGCAGCAGG - Intergenic
1018047947 6:159981131-159981153 GCTTCCAGCAGAAGAGCAGCAGG - Intronic
1018096662 6:160393195-160393217 GGACCCAGGTGACCATCAGCTGG - Intronic
1019150202 6:170000528-170000550 GCCTCCAGGGGGACAGCAGCAGG - Intergenic
1019783576 7:2959187-2959209 CCATCCAGGAGCCCAGCTGGGGG + Intronic
1019855178 7:3598519-3598541 ACAGCCAGGACACCAGCATCAGG + Intronic
1020233738 7:6339800-6339822 GCATCCAGGGGACCGGGAGGGGG - Intronic
1020288028 7:6700828-6700850 GCACTCAGGAGACCAGCATTAGG - Intronic
1021318542 7:19182300-19182322 CCATCCAGGAGCCTAGCAACAGG + Intergenic
1022567668 7:31419568-31419590 GCATCAAGGCCACCAGAAGCTGG - Intergenic
1023758607 7:43443559-43443581 GAATCCAGTAGAACAGCTGCAGG + Intronic
1025019965 7:55473031-55473053 TCTTTCAGGAGCCCAGCAGCCGG - Exonic
1027233646 7:76285749-76285771 GCAGCCATGGGACCCGCAGCCGG + Exonic
1028816833 7:95156585-95156607 GCACACAGGAGACCTGCAGAGGG + Intronic
1028938812 7:96495975-96495997 GCATCTAGGAAAACAGCCGCAGG + Intronic
1029073969 7:97921533-97921555 CCATCTTGTAGACCAGCAGCTGG + Intergenic
1029188907 7:98758395-98758417 ACATCAAGGAGACCAGCAGCAGG + Intergenic
1033724210 7:144095740-144095762 GCAAGTAGGAGACCAGCACCAGG - Exonic
1033727018 7:144129745-144129767 GCAAGTAGGAGACCAGCACCAGG - Exonic
1034466726 7:151234092-151234114 GGATCCAGGAAACCCGCAGGAGG - Exonic
1034978053 7:155459229-155459251 GCGGCCAGGAGTCCAGCGGCAGG + Intronic
1035516766 8:240369-240391 GTATCCAGAGGACCAGCAGAAGG + Intronic
1036257065 8:7214295-7214317 CCATCTTGTAGACCAGCAGCTGG + Intergenic
1036309115 8:7672894-7672916 CCATCTTGTAGACCAGCAGCTGG + Intergenic
1036360420 8:8073225-8073247 CCATCTTGTAGACCAGCAGCTGG - Intergenic
1036546850 8:9779508-9779530 GTATCCAGCAGGCCAACAGCAGG - Exonic
1037759495 8:21732571-21732593 GCCCCCATGAGACCAGCAGGAGG + Intronic
1038013548 8:23494110-23494132 TGAGCCAGGAGACCAGCAGCAGG - Intergenic
1038199593 8:25399940-25399962 GCATCCTGAAGACCAGGAGAAGG + Exonic
1043672411 8:82904072-82904094 GCTTCCTGGATACCAGCTGCTGG - Intergenic
1047151710 8:122271457-122271479 GCATCCAGGAGTGGAGGAGCGGG + Intergenic
1048339074 8:133525159-133525181 GCTTTCAGGAGACCTGCAGTGGG + Intronic
1050113842 9:2242699-2242721 GCCTCCCCGAGATCAGCAGCTGG - Intergenic
1052846194 9:33338628-33338650 GCTTCCAGAAGCCCAGCACCTGG - Intronic
1053556836 9:39146175-39146197 GCATGCAGAAGACCAACAGAGGG + Intronic
1053820947 9:41966453-41966475 GCATGCAGAAGACCAACAGAGGG + Intronic
1054089815 9:60834592-60834614 GCATGCAGAAGACCAACAGAGGG + Intergenic
1054111226 9:61110150-61110172 GCATGCAGAAGACCAACAGAGGG + Intergenic
1054609631 9:67220975-67220997 GCATGCAGAAGACCAACAGAGGG - Intergenic
1056747673 9:89318532-89318554 GCGTCACGGAGGCCAGCAGCGGG - Exonic
1056788825 9:89612130-89612152 GCATCCAGGTGAGAAGCAGGTGG - Intergenic
1058525619 9:105855160-105855182 GAAGCCAGGAAACCAGCAGAGGG - Intergenic
1059922786 9:119177287-119177309 ACAGCCTGGAGAACAGCAGCAGG + Intronic
1060134329 9:121137067-121137089 GCCTCCAGGATGCCAGGAGCAGG + Intronic
1060186886 9:121568945-121568967 GCTTCCAGGAGATCAGCAACCGG - Intronic
1060300180 9:122370543-122370565 TCATCTAGGAAACCATCAGCAGG + Intronic
1060975298 9:127761698-127761720 GCAGGCAAGAGACCGGCAGCTGG - Intronic
1061819526 9:133218537-133218559 GCATCCAGGAGAACAGGGGATGG + Intergenic
1062077084 9:134595288-134595310 CCCCCCGGGAGACCAGCAGCAGG - Intergenic
1062152569 9:135029432-135029454 GCATCCAGGAGAACCTCAGGAGG - Intergenic
1062241161 9:135539652-135539674 GCATCCAGGAGAACAGGGGATGG - Intergenic
1062570428 9:137182607-137182629 GCCCCCAGGAGCCGAGCAGCAGG - Intronic
1062648696 9:137564473-137564495 GCATGCAGGCGGCCAGGAGCAGG + Exonic
1186213683 X:7276678-7276700 GGATCCAGAATACCTGCAGCTGG + Intronic
1186768095 X:12791604-12791626 GCAACCAGGAGACCAGGTGGGGG + Exonic
1186849903 X:13569888-13569910 CCACCCAGGAGAGCAGCAGCGGG - Exonic
1187521001 X:20013993-20014015 GGATCCAGGAGACCAGCCTGTGG - Intronic
1189345562 X:40238646-40238668 GCATCCAGGAGACTACCTGGGGG - Intergenic
1190687524 X:52888018-52888040 ACATCCAGGAGGGCAGGAGCTGG - Intergenic
1190698458 X:52967774-52967796 ACATCCAGGAGGGCAGGAGCTGG + Intronic
1190772190 X:53524444-53524466 ACAACCAAAAGACCAGCAGCTGG - Intergenic
1190781205 X:53597517-53597539 ACAACCAAAAGACCAGCAGCTGG - Intronic
1193645790 X:84066861-84066883 CCATACAGGAGAGCACCAGCTGG + Intronic
1194208432 X:91039574-91039596 GCATACAGGAGAGCTCCAGCAGG - Intergenic
1195319151 X:103707180-103707202 GGAAGCAGGAGGCCAGCAGCAGG + Intergenic
1197174878 X:123474854-123474876 GAATCCAGGAGACCACCAGCTGG + Intronic
1198690673 X:139280759-139280781 GCAGCCAGGACACCAGTGGCTGG + Intergenic
1199773329 X:150989243-150989265 GCATCCAGGAGACCAGCAGCAGG - Exonic
1200886871 Y:8279916-8279938 GCACACAGGAGCCCAGTAGCCGG - Intergenic
1201078049 Y:10201022-10201044 GCATCCAGGGGACCATCACCAGG - Intergenic
1201913668 Y:19158921-19158943 GAATCCAACAGACCTGCAGCTGG + Intergenic