ID: 1199773785

View in Genome Browser
Species Human (GRCh38)
Location X:150993238-150993260
Sequence CTAGTATTCAAAATATATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199773781_1199773785 25 Left 1199773781 X:150993190-150993212 CCTACAGAATGGGGGAAAATATT 0: 48
1: 2546
2: 14128
3: 17872
4: 10086
Right 1199773785 X:150993238-150993260 CTAGTATTCAAAATATATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199773785 Original CRISPR CTAGTATTCAAAATATATAA AGG Intergenic
No off target data available for this crispr