ID: 1199778117

View in Genome Browser
Species Human (GRCh38)
Location X:151033460-151033482
Sequence GAGGGCAGGTCTCTGTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199778112_1199778117 10 Left 1199778112 X:151033427-151033449 CCAAGGACAGGTCTGTGGGGCAA No data
Right 1199778117 X:151033460-151033482 GAGGGCAGGTCTCTGTGAAGAGG No data
1199778110_1199778117 12 Left 1199778110 X:151033425-151033447 CCCCAAGGACAGGTCTGTGGGGC No data
Right 1199778117 X:151033460-151033482 GAGGGCAGGTCTCTGTGAAGAGG No data
1199778106_1199778117 21 Left 1199778106 X:151033416-151033438 CCAGGGTAACCCCAAGGACAGGT No data
Right 1199778117 X:151033460-151033482 GAGGGCAGGTCTCTGTGAAGAGG No data
1199778111_1199778117 11 Left 1199778111 X:151033426-151033448 CCCAAGGACAGGTCTGTGGGGCA No data
Right 1199778117 X:151033460-151033482 GAGGGCAGGTCTCTGTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199778117 Original CRISPR GAGGGCAGGTCTCTGTGAAG AGG Intergenic
No off target data available for this crispr